Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 852

1 members and 851 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,781
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 10 of 64

Threaded View

  1. #26
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by littleindiangirl View Post
    Are you 100% on that?

    Are you 100% on that too?

    Are you 100% on that one too?

    And this?
    I am not 100% on anything and I have said that through out my postings.

    No on is ignoring your speculation,
    Well I have not heard it spoken of anywhere so I do not think it is unreasonable to consider the possibility that it was not an idea tossed around. If no one is talking about it how am I to know that others are thinking about it? Hmmm??

    however genetics in of themselves are complicated,
    There is a reason for my signature I am not a neophyte to genetics.

    and many are simply trying to wrap their heads around what co-dom vs incomplete dom really means.
    Yes, something that has not escaped my attention.

    Randy Remington is the guy people go to for guidance in understanding ball python genetics.
    That may be. I honestly would not know Randy from Joe on the street. From what I have read that Randy has posted I have enormous respect for him. (Cheers Randy ) However, just cause he is the "go to" guy does not make him the end all be all. "Authorities" and "experts" can still be wrong. And sometimes it is not that they are wrong it is just that there is something they may not have considered that an outside source might. In point of fact any real expert will happily admit that they do not know everything and will readily hear out other ideas.

    Your broad declarations on the results from ball python breedings is really quite authoritative.
    No more so than half the other broad declarations I have read on forums... Nothing authoritative about it. Point of fact I pretty much ripped that part about pastel breeding word for word from another thread here so... I was using it as an example, nothing more and nothing less.

    That is moot however because I have said all along that I am:

    1) Playing devil's advocate

    2) Making generalizations

    I am not claiming anything as 100% fact (as you seem to be accusing me of) but I am trying to get people to engage in an idea that I do not think is without merit. If nothing else just for some interesting conversation on an interesting topic.

    Have you been to a reptile show? Have you seen the multitudes of dirty brown pastels and normal looking co-dom morphs?
    Yes I have. That point does not prove anything.

    I would think it's safe to say that few people are truly working on selective breeding, even far less likely are they accidentally selectively breeding for a trait that could be a marker.
    That is a rather broad declarations you are making quite authoritatively.

    Personally, I am more inclined to think that serious breeder are being quite selective and that is obvious in the fact that they do not sell crap animals like $75 pastels and $300 lessers. Any closet breeder can slap two animals together for the intent of making a quick buck and co-coms are a great way to do that cause you get instant results. Investing a couple thousand in a pied is a little different (at least to me).

    I bring up deserts as my example number one. Look at the pattern changes the desert morph does to HET recessive animals like the desert het clown? Wow... it's really amazing.
    Yes it is amazing. But are you 100% certain that that is all down to the desert? What if that is something about the clown? Or maybe a hidden gene? Or maybe none of the above but a maternally inherited RNA factor (maybe the reciprocal will look different? Who can say?)

    Or perhaps there are genes at work in the marker animals that are expressed in the phenotype as "markers" when the heterozygous form of the recessive morph gene is present?
    Never denied that. As I have said all along I could be wrong. I am more than happy to admit that.

    Maybe the way these genes work are not so cut and dry that we can say for CERTAIN that they only work this way, and there is NO possibility that the interactions, distance, or accumulation of genes has no phenotypical expression when the recessive gene of the desired morph is only heterozygous.
    And once again, I never denied any of these things. I do find it ironic that you can sit here and lecture me about it not being so "cut and dry" when the whole point of my playing devil's advocate (as I have been saying I was doing all along) was done to get people to realize that maybe this whole marker thing is not as cut and dry as it is being made out to be...

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    broadude (12-18-2008),Lexcorn (12-18-2008)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1