Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 801

2 members and 799 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Page 6 of 7 FirstFirst 1234567 LastLast
Results 51 to 60 of 64
  1. #51
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by kthulhu View Post
    Like everyone is saying, this is definetlely not cut and dry, especially since there is no sequenced genom information on ball pythons and we really have no idea what genes are actually responsible for what mutation.
    Hey if someone is willing to fund me a grant I'd be more than happy to do the wetwork to get the sequence . IIRC a single run on one of the next-gen sequencer systems (SOLiD, Illumina) is around $20K (~8 samples/run). Figure in having to build up new chips since it is an untapped organism so make it $50K for first run and to establish the WT baseline. And then a second run on a pied animal to get the mutation isolated, that is another $20K. And then add in a large margin for fudge and we'll cal lit $85K total.

    Anyone got $85K laying around LOL??
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #52
    BPnet Veteran broadude's Avatar
    Join Date
    05-20-2005
    Location
    United States
    Posts
    731
    Thanks
    477
    Thanked 101 Times in 84 Posts

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by asplundii View Post
    Hey if someone is willing to fund me a grant I'd be more than happy to do the wetwork to get the sequence . IIRC a single run on one of the next-gen sequencer systems (SOLiD, Illumina) is around $20K (~8 samples/run). Figure in having to build up new chips since it is an untapped organism so make it $50K for first run and to establish the WT baseline. And then a second run on a pied animal to get the mutation isolated, that is another $20K. And then add in a large margin for fudge and we'll cal lit $85K total.

    Anyone got $85K laying around LOL??

    If all breeders could kick in 1K it would be doable.


    "Price has very little to do with QUALITY. Quality stands on its own merit and doesn't need a hefty price tag to prove its worth."

  3. #53
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by broadude View Post
    If all breeders could kick in 1K it would be doable.
    I am sure it would

    Heck, if I could get enough interest I'd shot to get all the morphs sequenced. I'd love to see how the clusters of related mutations sort out. (i.e. lesser/mojo/phantom, black paster/cinny, all the hypos, the axanthics...)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #54
    Registered User Lexcorn's Avatar
    Join Date
    02-01-2007
    Location
    U.K. / Europe
    Posts
    122
    Thanks
    19
    Thanked 27 Times in 18 Posts

    Re: Is there a way to tell het pied on appearance?

    Original post by asplundii

    Personally, I am more inclined to think that serious breeder are being quite selective and that is obvious in the fact that they do not sell crap animals like $75 pastels and $300 lessers. Any closet breeder can slap two animals together for the intent of making a quick buck and co-coms are a great way to do that cause you get instant results. Investing a couple thousand in a pied is a little different (at least to me).
    Yup, one of many good points in your posts.

    A good debate on the pied 'marker'.

    It is quite a reasonable hypothesis that the 'marker' is, indeed, due to selective breeding. A thought that cannot be completely overlooked.

    Excellent examples of the b.p. ventral to highlight the discussion.


    Lex

  5. #55
    Registered User
    Join Date
    12-12-2007
    Posts
    18
    Thanks
    5
    Thanked 1 Time in 1 Post
    Images: 7

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by asplundii View Post
    Hey if someone is willing to fund me a grant I'd be more than happy to do the wetwork to get the sequence . IIRC a single run on one of the next-gen sequencer systems (SOLiD, Illumina) is around $20K (~8 samples/run). Figure in having to build up new chips since it is an untapped organism so make it $50K for first run and to establish the WT baseline. And then a second run on a pied animal to get the mutation isolated, that is another $20K. And then add in a large margin for fudge and we'll cal lit $85K total.

    Anyone got $85K laying around LOL??
    Haha yea I wish I had some extra grant money laying around. Man I'm so glad I work with bacteria and only have to worry about only two chromosomes! Hey and while you're at it, go ahead and start synthesizing some RNAi and make some random new morphs lol. Gotta love genetics!

  6. #56
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by kthulhu View Post
    Gotta love genetics!
    Yes indeed Nothing like the ATGC to fill your days LOL

    Haha yea I wish I had some extra grant money laying around
    You and I should combine our knowledge and start a business LOL
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #57
    BPnet Veteran DrLew's Avatar
    Join Date
    10-22-2008
    Location
    North Carolina
    Posts
    342
    Thanks
    50
    Thanked 46 Times in 42 Posts
    Images: 5

    Re: Is there a way to tell het pied on appearance?

    And THAT my friends - is the only way to tell a het pied.......



    Quote Originally Posted by asplundii View Post
    Hey if someone is willing to fund me a grant I'd be more than happy to do the wetwork to get the sequence . IIRC a single run on one of the next-gen sequencer systems (SOLiD, Illumina) is around $20K (~8 samples/run). Figure in having to build up new chips since it is an untapped organism so make it $50K for first run and to establish the WT baseline. And then a second run on a pied animal to get the mutation isolated, that is another $20K. And then add in a large margin for fudge and we'll cal lit $85K total.

    Anyone got $85K laying around LOL??
    1.1 Brazilian Rainbow Boas
    1.0 Anerythrystic Brazilian Rainbow Boa
    1.1 Het Albino Red Tail Boas
    1.0 Albino motley Red Tail
    1.2 Green tree pythons
    1.1 Emerald Tree Boas
    2.2 Corn snakes
    1.3 Honduran Milks (1.1 alb, 0.1 het alb, 0.1 dbl het)
    3.4 Ball pythons (Lemon bee, Spider & Pied males. 2 Pastels,poss het pied, girls)

  8. #58
    BPnet Veteran
    Join Date
    11-13-2003
    Location
    Colorado
    Posts
    1,555
    Thanks
    6
    Thanked 247 Times in 186 Posts
    Images: 28

    Re: Is there a way to tell het pied on appearance?

    Here is one of my keepers this year.



    One of her great great grandparents was a pied. Of course it will take me a few more years to get her up to size to see if my hunch that she has a better than 12.5% chance of being a het pied is accurate. Sure the marker could be a separate gene that has been passed down through 4 consecutive generations of outbreeding. However, to me it looks very pied like and I've seen pictures of some of her aunts that are so extreme markered with the white starting to move up the side that they could pass for low white pieds. Remember that pieds have white bellies and only vary by how much the white expands onto the back (or maybe more accurate to say how much the pigment doesn't extend down). Based on these observations I believe that the marker belly is an expression of a single pied mutation and not a separate gene. The guy I got her father from reports that all of his 25% chance het pied sisters with the markers have proven so technically my girl is now upgraded to 25% chance het pied since her aunts proved her 50% chance het pied markered grandfather.

  9. #59
    Registered User Lexcorn's Avatar
    Join Date
    02-01-2007
    Location
    U.K. / Europe
    Posts
    122
    Thanks
    19
    Thanked 27 Times in 18 Posts

    Re: Is there a way to tell het pied on appearance?

    She's a beauty Randy,

    Certainly well worth holding onto not only for test breeding for confirmation of the 'marker' trait, but, also for her obvious quality.

    It will be some time before you are able to up date us on this girl though.

    Good luck with her.

    Lex

  10. #60
    BPnet Senior Member Brandon Osborne's Avatar
    Join Date
    08-14-2008
    Location
    Indiana
    Posts
    1,225
    Thanks
    217
    Thanked 693 Times in 350 Posts
    Images: 5

    Re: Is there a way to tell het pied on appearance?

    Randy, that is a perfect example of a het Pied marker. Everyone needs to look close at the belly, not just the stripes on the sides of the belly. Het Pied markers are different than the normals with " marker" bellies. I would put money on that animal being 100% het. Like I said before, it's not just about the stripes and the belly.

    Brandon Osborne

    Quote Originally Posted by RandyRemington View Post
    Here is one of my keepers this year.



    One of her great great grandparents was a pied. Of course it will take me a few more years to get her up to size to see if my hunch that she has a better than 12.5% chance of being a het pied is accurate. Sure the marker could be a separate gene that has been passed down through 4 consecutive generations of outbreeding. However, to me it looks very pied like and I've seen pictures of some of her aunts that are so extreme markered with the white starting to move up the side that they could pass for low white pieds. Remember that pieds have white bellies and only vary by how much the white expands onto the back (or maybe more accurate to say how much the pigment doesn't extend down). Based on these observations I believe that the marker belly is an expression of a single pied mutation and not a separate gene. The guy I got her father from reports that all of his 25% chance het pied sisters with the markers have proven so technically my girl is now upgraded to 25% chance het pied since her aunts proved her 50% chance het pied markered grandfather.
    Brandon Osborne

    Like Osborne Reptiles on Facebook!
    http://www.facebook.com/osbornereptiles
    Take a look at our website!
    www.osbornereptiles.com

Page 6 of 7 FirstFirst 1234567 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1