Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 845

1 members and 844 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,781
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 10 of 64

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Is there a way to tell het pied on appearance?

    Quote Originally Posted by RandyRemington View Post
    We seem to have several examples of sporadic traits that give every indication of being part of the mutations we are breeding for. I don't know what controls when they get expressed and when they don't.
    I'll start by saying I know jack about Burms so I am not going to even try to address them but:

    1. The wobble in spiders. If it wasn't a side effect of the actual spider mutation surely the linkage would be broken with all the spider outbreeding by now and someone would be selling a line of guaranteed 100% non looping spiders.
    I do not have a lot of first hand experience with spiders but all I have read and heard form the tops in the game indicates that all spiders wobble to some extent or another. Additionally, like the Jag morph in carpets, all spiders are reported to be a little "off" in other ways.

    2. Kinking in caramels. Although recessive there has also been a lot of work on outbreeding but still many caramels kink but not 100% of them.
    Granted not all caramels kink, but you never see a higher rate of kinking in the hets do you? The kinking condition is a result of a pathway disruption that is only there when both recessive alleles are present, in the presence of a WT allele there is no indication that the animal is a het unless you know that based on breeding.

    3. Kinking and duck bill in homozygous cinnamon/black pastel. Same thing, seen consistently but not always.
    Again, you are talking homozygous vs. heterozygous condition. The specific condition is the result of a homozygous induced disruption. In the heterozygous condition there is no indication of any other factor associate.

    These non absolutes aren't neat and tidy but they seem to be real even though they are seen sporadically. To me the wide white belly with dark lines at the edge and intricate and bright back pattern seen in many but not all het pieds looks a lot like the start of the pied white creeping up from the belly and the dark lines and bright color seen in the non white areas of a homozygous pied. Maybe being homozygous pied and to a lesser degree het pied resists the migration of color from the neural crest down leaving the white belly and in a homozygous pied also white some places on the back. Just like homozygous pieds vary in how restricted the color is (i.e. how high the white is) perhaps the hets can vary too due to other genetics, chance, or perhaps even incubation environment.
    I do not deny that the above mentioned conditions are real but I do not think they are exactly in the same range of condition as the het pied marker. If pied is a recessive trait then the hets should be phenotype WT. If they are not phenotype WT then pied has to be a co-dom trait (albeit a state where the het form is a very very subtle one but we have that like with a few other morphs so it is not unheard of.)

    Honestly I have no real stance either way, I am just playing devil's advocate. And it still seems that no one is willing to even consider that the marker could very well be the result of unintentional selective breeding.

    Look at it in this manner:

    When someone is breeding a pastel to a WT they usually pick a WT with high yellow/gold so as to enhance the pastel effect (why breed a pastel to a dark animal if it is just going to give you sub par pastels?) As a result, WT offspring from pastel breedings tend to be higher yellow animals.

    Now apply this same logic to pied breedings in terms of accidental marker selection. A "preferred" way of breeding for recessive traits is to breed the homozygous recessive to a het so that all offspring are either the recessive or 100% hets. Now, some how (does not matter if it was accident or intent) the marker was assigned as a trait of het pieds. Someone gets an animal with the marker and breeds it to their pied. Only hets were produced in the clutch, and for arguments sake say half have the marker. Now, marker and pied are separate but because of the correlation assigned to the marker more people are inclined to breed the marker animals in their projects. A couple rounds of breeding marker carrying het pieds and you have enriched for the marker trait in offspring of pied breedings in the same manner that you have enriched for high yellow animals in pastel breedings.


    Granted, I could be wrong. More than happy to admit that. All I am trying to do is offer and argument that many people seem to be ignoring as a possibility.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    broadude (12-18-2008)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1