Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 795

0 members and 795 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,103
Posts: 2,572,095
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 33

Threaded View

  1. #25
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by colin-java View Post
    That is a fairly decent break-down. Only caveat I would put on it is that the sex part is incorrect with respect to ball pythons (really, all pythons and boas if you want to be technical) as balls are X/Y and not the Z/W that Komodos are
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Bogertophis (06-17-2020)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1