Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,905

0 members and 1,905 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,069
Threads: 249,219
Posts: 2,572,797
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Page 4 of 4 FirstFirst 1234
Results 31 to 33 of 33
  1. #31
    Registered User
    Join Date
    03-14-2019
    Posts
    84
    Thanks
    50
    Thanked 40 Times in 25 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by asplundii View Post
    That is a fairly decent break-down. Only caveat I would put on it is that the sex part is incorrect with respect to ball pythons (really, all pythons and boas if you want to be technical) as balls are X/Y and not the Z/W that Komodos are

    I thought everything was X and Y, at least within vertebrates, but its much more complex than that...

    In snakes[edit]

    Snake W chromosomes show different levels of decay compared to their Z chromosomes. This allows for tracking the shrinking of W chromosomes by comparing across species. Mapping of specific genes reveals that the snake system is different from the bird system. It is not yet known which gene is the sex-determining one in snakes. One thing that stood out was that Python show little signs of "W-shrinking".[6]
    Boa and Python families are now known to probably have an XY sex-determination system.[17] Interest in looking into this came from female family members capable of parthenogenesis, or producing offspring without mating. In 2010 a female Boa constrictor that produced 22 female offspring in this manner was found in the wild. By then it was presumed that such a pattern was produced by WW chromosomes.[18] Python bivittatus and Boa imperator, similarly only produce female offspring; their genomes share male-specific single nucleotide polymorphisms identifiable by restrictive enzyme digestion. Their chromosomal origins, however, differ: Python's XY are similar to other snakes' ZW, while Boa XY maps to microchromosomes in other snakes.[19] The female-only pattern is in contrast to the ZW Colubroidean parthenogens, which always produce male (ZZ) offspring.[20]

  2. #32
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by colin-java View Post
    I thought everything was X and Y, at least within vertebrates, but its much more complex than that...
    Nope. All mammals are X/Y, all birds are Z/W, amphibians lizards, snakes and insects have both (which is to say that some do X/Y and some do Z/W and not they have all four at once)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #33
    Registered User
    Join Date
    03-14-2019
    Posts
    84
    Thanks
    50
    Thanked 40 Times in 25 Posts

    Re: Parthenogenesis occurred

    Quote Originally Posted by Bogertophis View Post
    All the best with your gal...I don't expect her to go off-food for quite a while this year- if at all, but only time will tell. We'll be curious, right along with you, to see what's next.
    She just shed today, and I gave her a 220g F/T rat warmed up and she constricted it in about a second.
    So 2 out of 2 now.
    She wouldn't settle in her hide box the week following the eggs, but then slowly started to settle a bit more.
    Then after the first rat she hasn't come out of the box at all, so it looks like things are getting back to normal now.

  4. The Following 2 Users Say Thank You to colin-java For This Useful Post:

    Bogertophis (06-24-2020),EL-Ziggy (06-24-2020)

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1