» Site Navigation
1 members and 1,798 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,716
Top Poster: JLC (31,651)
|
-
Registered User
Parthenogenesis occurred
My 25 year old bp has just laid 6 eggs, 4 with veins in.
I wasn't expecting it, so don't have an incubator set up, she is incubating them right now.
Should I try to incubate them or get rid of them as I've heard they can be sickly if they develop?
I'm not sure if maternal incubation is a good idea, as I want to get her back to a good weight as she is thin right now.
Thanks for any advice.
-
-
Really your call. There is a greater chance of defects in any that hatch, but I have to tell you that right now I have 3 lovable near-yearling Florida rat snakes from one
of my adult-NEVER-BRED females. Every year she & her sister lay dozens of eggs, many of which look good, & last year I decided to incubate the ones that appeared
to be good eggs- just out of curiosity.
Most of the eggs went "south", some almost hatched (had non-viable snakes that failed to emerge), but ultimately there were 3 tiny snakes looking back at me with
vigor. Of those 3, only one had some non-severe kinks (some bumps in her tail, plus a moderate mid-body kink that I feared might restrict adequate digestion-
but which is now very hard to even see, much less cause her problems). Their personalities couldn't be more different...one is quite feisty & still dislikes being handled-
like you'd expect from a wild rat snake, but the other 2 are excellent pets...all are eating & growing well. Wouldn't you know it, the one with kink imperfections is also
amelanistic...a pale peachy color with only a hint of pattern, with an exceptionally calm demeanor...she'll sit wrapped on my left hand while I feed her from my right...
without biting me or making any mistakes. And she climbs branches in her cage with ease, no trace of any disability. I've also been hand-feeding the other one- once
she decides to sit still, she also makes no 'mistakes' thus far, eating while held on my lap. They may out-grow this cute phase of being hand-feedable...these rat snakes
have formidable appetites & "skills", but right now they're showing their adaptability & intelligence...hate to think I might have missed it. 
I must admit that while I needed more snakes "like a hole in the head", I'm delighted to know them all. Does that answer your question?
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following 2 Users Say Thank You to Bogertophis For This Useful Post:
colin-java (06-05-2020),LyraIsGray (06-04-2020)
-
Partho babies tend to be a little weaker and you can generally expect a high mortality rate. That said, I know people that have had partho clutches with >90% survival.
The bigger caution I would give you is that, since they will all be female, is that if you breed them once they are fully grown you will likely get terrible clutches and may lose them. Warren Booth has seen this in both boas and balls when he has bred partho animals he produced.
As far as MI... It should be fine, they have been doing it for millions of years before we started keeping them as pets. You can also try offering very small prey items, on rare occasions females on eggs will eat.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (06-04-2020),colin-java (06-05-2020)
-
I agree ^ ^ ^ ^ ^ and I'd never breed these snakes in the future. Good luck whatever you decide.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Registered User
Re: Parthenogenesis occurred
 Originally Posted by Bogertophis
Really your call. There is a greater chance of defects in any that hatch, but I have to tell you that right now I have 3 lovable near-yearling Florida rat snakes from one
of my adult-NEVER-BRED females. Every year she & her sister lay dozens of eggs, many of which look good, & last year I decided to incubate the ones that appeared
to be good eggs- just out of curiosity.
Most of the eggs went "south", some almost hatched (had non-viable snakes that failed to emerge), but ultimately there were 3 tiny snakes looking back at me with
vigor.  Of those 3, only one had some non-severe kinks (some bumps in her tail, plus a moderate mid-body kink that I feared might restrict adequate digestion-
but which is now very hard to even see, much less cause her problems). Their personalities couldn't be more different...one is quite feisty & still dislikes being handled-
like you'd expect from a wild rat snake, but the other 2 are excellent pets...all are eating & growing well. Wouldn't you know it, the one with kink imperfections is also
amelanistic...a pale peachy color with only a hint of pattern, with an exceptionally calm demeanor...she'll sit wrapped on my left hand while I feed her from my right...
without biting me or making any mistakes. And she climbs branches in her cage with ease, no trace of any disability. I've also been hand-feeding the other one- once
she decides to sit still, she also makes no 'mistakes' thus far, eating while held on my lap. They may out-grow this cute phase of being hand-feedable...these rat snakes
have formidable appetites & "skills", but right now they're showing their adaptability & intelligence...hate to think I might have missed it.
I must admit that while I needed more snakes "like a hole in the head", I'm delighted to know them all. Does that answer your question?
Thanks for the advice, its awesome you have a partho ratsnake that's doing well.
From the 6 bps I've heard of that were partho, 4 died and 1 had a defect like a lump, something to do with the umbilical scar.
I decided not to keep them, I would probably screw up the incubation anyway as I've never done it before.
And being an older snake, I guess there could be more chance of defects.
The whole egg laying thing has been a bit stressful, cause its meant to be about 30 days from prelay shed, but mine did it in 48 last year and 43 this year, I was paranoid they would never come and I would have to get them removed surgically.
I'm sure there's no eggs left inside her, but its possible theres a slug, but nothing I can do really, she's lost about 1kg in weight, from 2900g to 1900g, so I've gotta get her eating next week.
Thanks again
Last edited by colin-java; 06-04-2020 at 09:31 AM.
-
The Following 3 Users Say Thank You to colin-java For This Useful Post:
Bogertophis (06-04-2020),EL-Ziggy (06-04-2020),GoingPostal (06-04-2020)
-
Re: Parthenogenesis occurred
My female bullsnake has laid up to 20 eggs each year for the past 3 years. I just toss them out. I feel sorry for her because she loses so much weight. I try to get the weight back on her but she's never gotten her original girth back since this all started.
3.0 Carpet Pythons, 1.1 Bullsnakes
1.0 Olive Python 1.0 Scrub Python,
1.0 BI, 0.1 BCO
-
The Following 3 Users Say Thank You to EL-Ziggy For This Useful Post:
Bogertophis (06-04-2020),colin-java (06-05-2020),LyraIsGray (06-04-2020)
-
Registered User
Re: Parthenogenesis occurred
Oh crumbs, are they live eggs with veins, or just plain eggs?
How old is she?
I don't get why mine has just started doing this from last year, and none of the years before.
-
-
Re: Parthenogenesis occurred
 Originally Posted by colin-java
Oh crumbs, are they live eggs with veins, or just plain eggs?
How old is she?
I don't get why mine has just started doing this from last year, and none of the years before.
I didn't see any veins. I assumed they'd all be infertile. She was hatched in late June 2013 so she'll be 7 in a few weeks. I want to get her back to size but don't want to feed her too often either. Right now she's eating about every 10 days. I thought weekly feedings might be too frequent at her age but I'm sure she'd love it. A 25 year old snake is a nice achievement. Congratulations!
Last edited by EL-Ziggy; 06-04-2020 at 12:13 PM.
3.0 Carpet Pythons, 1.1 Bullsnakes
1.0 Olive Python 1.0 Scrub Python,
1.0 BI, 0.1 BCO
-
The Following User Says Thank You to EL-Ziggy For This Useful Post:
-
Re: Parthenogenesis occurred
Last edited by Bogertophis; 06-04-2020 at 01:13 PM.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
-
Re: Parthenogenesis occurred
 Originally Posted by EL-Ziggy
I didn't see any veins. I assumed they'd all be infertile....
....A 25 year old snake is a nice achievement. Congratulations!
Sometimes you have to wait a few days for the veins to show up real well...you might be surprised how many are potentially "live". 
And yes, I agree...Congratulations colin-java, on your 25 year old snake!
Last edited by Bogertophis; 06-04-2020 at 01:10 PM.
Rudeness is the weak man's imitation of strength.
Eric Hoffer (1902 - 1983)
“The greatness of a nation and its moral progress can be judged by the way its animals are treated.” ~ Gandhi
-
The Following User Says Thank You to Bogertophis For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|