Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 694

0 members and 694 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 29

Threaded View

  1. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I swore I was not going to get into this but...

    Quote Originally Posted by skydnay View Post
    Jumping back to this, you're referring to a chimera, where one animal contain, more or less, the mashed together DNA of two animals. So, this begs the question, are chimerism and paradoxing the same thing? If so, then this wouldn't necessarily be something you can breed for.
    Quote Originally Posted by paulh View Post
    A chimera does NOT have the mashed together DNA of two different animals. A chimera has the CELLS of two different animals. The cells have not been mashed together enough to make two cells into one cell. The cells are only mashed together enough to make them grow into a single animal. A given cell has the DNA of either one or the other original fertilized egg. The DNA of that cell is identical to the DNA of the progenitor fertilized egg.
    Neither of these are quite correct but Paul is close.

    A chimera is when an individual has cells with two distinct genetic populations within their bodies. In many cases this occurs when two genetically distinct zygotes fuse and then go on to develop into a single viable embryo, however there are other mechanisms by which this can happen.


    Quote Originally Posted by paulh View Post
    A paradox is a chimera plus. A paradox has cell lines of two different animals plus the genetics of those two animals is different enough to identify that cell lines come from two different animals.
    This is not correct.

    First off we need to establish something that I have said numerous times on many different platforms (and which seems to be consistently ignored):

    "Paradox" is a completely ILLIGITIMATE term used within the hobby that has zero scientific meaning.

    Please go back and read that sentence again.

    Within the hobby the term "paradox" is used to describe any animal displaying areas of pigmentation/pattern that are contrary to the accepted base morph of the animal. So, in terms of pigmentation, an Albino animal with a patch of normal melanin pigmented skin would be "paradox" and, flipping it around, a normal-coloured animal with an Albino-like amelanistic patch would also be "paradox". A pattern-type "paradox" would be a Spider with a patch of WT patterning on it or, flip side, a WT with a patch of Spider pattern.

    So... Is a chimera a "paradox"? Yes. And a mosaic is also a "paradox". And a localized chromosomal disjunction giving rise to a population of monoallelic cells is also a "paradox". And reactivation of a gene through the excision of a transposon is also a "paradox". And all the other strange and bizarre genetic foibles that can give rise to atypical localized pigment/pattern display are all also "paradox".



    As far as whether or not "paradox" is a breedable trait... Never say never as they say. But given that there are numerous different mechanisms that can give rise to a "paradox" phenotype (a few of which I listed above) and that most of them are fluke occurrences, I think the odds are against it. That said, there are the reported Whitewash and Atomic animals however, neither of these has been proven and the originators of both of these projects have gone rather silent on them. And I will also note that there are the "paradox" KSBs, however I know nothing about them other than that there does appear to be some consistency in their production.
    Last edited by asplundii; 09-14-2018 at 10:54 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 5 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (09-14-2018),jbrumley4201 (09-14-2018),LotsaBalls (09-14-2018),paulh (09-15-2018),skydnay (09-14-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1