» Site Navigation
2 members and 732 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,104
Posts: 2,572,099
Top Poster: JLC (31,651)
|
-
Re: What are Pieds? (Jinx)
 Originally Posted by TessadasExotics
Look im done with your silly argument.
My (and Brant's and Jinx's and Kewl's) arguments are not silly. They are actually well thought out and explained and backed up with significant experience.
 Originally Posted by TessadasExotics
You fail to grasp a simple concept of simpOre recessive.
I grasp simple recessive just fine thank you.
 Originally Posted by TessadasExotics
Pied is known for being recessive in all other animals as well as leucism. Just because you say its so, despite all other data is not the defining correct answer.
Pied is not known for being recessive. Pied was assigned the label "recessive" by someone early in the dark ages of herping who, like you, had an incomplete grasp of genetics. This is the same reason all of our inc-dom mutations are universally, wrongly, called co-dom. Someone who thought they knew more than they actually did started talking about something as if it were fact when it was not.
 Originally Posted by TessadasExotics
Genes can have an influence on other genes.
 Originally Posted by TessadasExotics
The genes we are working with in ball pythons are on more than just one locus. One locus can affect another. Just because you may be able to pick out a pastel het clown still does not make it not a recessive trait.
I never said they could not. But you are looking at it too narrowly. Regardless of any other mutations, there is a distinct yet subtle phenotype to the hets in Pied. In the presence of some mutations that subtle phenotype becomes less subtle, but it is always there. That makes them inc-dom.
 Originally Posted by TessadasExotics
Breedings of these mutarions prove without a doubt that they are simple recessive yet you continue to say otherwise.
No! I do not just "say otherwise". I (and other) look at data and trendlines observed by breedings of these mutations, by people with significantly greater experience and knowledge than you, which indicates that the decades-old label of recessive was premature and mistaken and that it is more appropriate to call them inc-dom.
As Nick Mutton is fond of pointing out: Specters and Paints are more subtle than het Pieds, why do we call them inc-dom?
 Originally Posted by TessadasExotics
Go ahead and keep missinforning others.
Careful who you make that accusation of.
 Originally Posted by TessadasExotics
This hobby is already missinformed as it is.
And as I have said numerous times I am not the one spouting off misinformation.
 Originally Posted by TessadasExotics
Its going to be funny when some people will start saying the breed codom clowns. Or seeing the look on breeders faces when someone tells them that their pied is codom.
I have said numerous times that I am still on the fence with Clown but there are plenty of breeders, big name ones at that, who already agree that Pied is inc-dom
 Originally Posted by TessadasExotics
The other thing I find funny. With my so called lack of knowledge on genetics. You have always agreed with what I have had to say before and now all of a sudden I dont have a clue about what im talking about.
I have never "always" agreed with you. And I can grant that I may have agreed with you on occasion in the past but that does not mean I will always agree with everything you say.
Also, I could make the same argument. Why now all of the sudden do you accuse me of not having a clue what I am talking about when you have agreed with me in the past??
 Originally Posted by TessadasExotics
Oh not to mention genes can become attached to others on a different loci. Do a little more research.
I do not need to do a little more research. Two genes cannot "fuse in to one" as Kevin claims happened with the HGW and Granite
 Originally Posted by TessadasExotics
He was the one that wants to attack… Hmm im pretty sure he was the one who started being rude/insulting, not I.
I was not attacking, rude or insulting. At least not by intent and I do apologize if it seemed that way.
I will say however that you accusing me of wantonly spreading misinformation was more than a little offputting.
 Originally Posted by TessadasExotics
As far as debating, he's not debating either. Just trying to belittle and over power with his "knowledge". Its all good he can
I accept the accusation that I am not debating because, frankly, I am not. But I am not belittling and overpowering as a means of getting my kicks in. As I have had to say to many many people before in situations like this: I never claimed to know more than everyone about everything. I know more than some people and I know less than other people. When I know less than someone, my goal is to learn. When I know more than someone I strive to teach. It is just really hard to try and teach someone when they are so set on refusing to listen to anything or consider that just maybe they could learn something.
 Originally Posted by TessadasExotics
I could care less how much of a genetics expert he thinks to be..
 Originally Posted by Royal Hijinx
I believe he in fact has a PhD in genetics... so you may want to re-assess your "comfort" with your "knowledge".
There is a reason my signature reads the way it does. Cheers Jinx
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 12 Users Say Thank You to asplundii For This Useful Post:
- + Show/Hide list of the thanked
-
BHReptiles (05-21-2013),Coleslaw007 (05-21-2013),Dave Green (05-21-2013),eatgoodfood (05-21-2013),HypoLyf (05-21-2013),Inarikins (05-21-2013),interloc (05-21-2013),Royal Hijinx (05-21-2013),satomi325 (05-21-2013),snakesRkewl (05-21-2013),STjepkes (05-21-2013),whispersinmyhead (05-21-2013)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|