Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 734

2 members and 732 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,104
Posts: 2,572,099
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 153

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by TessadasExotics View Post
    Look im done with your silly argument.
    My (and Brant's and Jinx's and Kewl's) arguments are not silly. They are actually well thought out and explained and backed up with significant experience.


    Quote Originally Posted by TessadasExotics View Post
    You fail to grasp a simple concept of simpOre recessive.
    I grasp simple recessive just fine thank you.


    Quote Originally Posted by TessadasExotics View Post
    Pied is known for being recessive in all other animals as well as leucism. Just because you say its so, despite all other data is not the defining correct answer.
    Pied is not known for being recessive. Pied was assigned the label "recessive" by someone early in the dark ages of herping who, like you, had an incomplete grasp of genetics. This is the same reason all of our inc-dom mutations are universally, wrongly, called co-dom. Someone who thought they knew more than they actually did started talking about something as if it were fact when it was not.


    Quote Originally Posted by TessadasExotics View Post
    Genes can have an influence on other genes.
    Quote Originally Posted by TessadasExotics View Post
    The genes we are working with in ball pythons are on more than just one locus. One locus can affect another. Just because you may be able to pick out a pastel het clown still does not make it not a recessive trait.
    I never said they could not. But you are looking at it too narrowly. Regardless of any other mutations, there is a distinct yet subtle phenotype to the hets in Pied. In the presence of some mutations that subtle phenotype becomes less subtle, but it is always there. That makes them inc-dom.


    Quote Originally Posted by TessadasExotics View Post
    Breedings of these mutarions prove without a doubt that they are simple recessive yet you continue to say otherwise.
    No! I do not just "say otherwise". I (and other) look at data and trendlines observed by breedings of these mutations, by people with significantly greater experience and knowledge than you, which indicates that the decades-old label of recessive was premature and mistaken and that it is more appropriate to call them inc-dom.

    As Nick Mutton is fond of pointing out: Specters and Paints are more subtle than het Pieds, why do we call them inc-dom?


    Quote Originally Posted by TessadasExotics View Post
    Go ahead and keep missinforning others.
    Careful who you make that accusation of.


    Quote Originally Posted by TessadasExotics View Post
    This hobby is already missinformed as it is.
    And as I have said numerous times I am not the one spouting off misinformation.


    Quote Originally Posted by TessadasExotics View Post
    Its going to be funny when some people will start saying the breed codom clowns. Or seeing the look on breeders faces when someone tells them that their pied is codom.
    I have said numerous times that I am still on the fence with Clown but there are plenty of breeders, big name ones at that, who already agree that Pied is inc-dom


    Quote Originally Posted by TessadasExotics View Post
    The other thing I find funny. With my so called lack of knowledge on genetics. You have always agreed with what I have had to say before and now all of a sudden I dont have a clue about what im talking about.
    I have never "always" agreed with you. And I can grant that I may have agreed with you on occasion in the past but that does not mean I will always agree with everything you say.

    Also, I could make the same argument. Why now all of the sudden do you accuse me of not having a clue what I am talking about when you have agreed with me in the past??


    Quote Originally Posted by TessadasExotics View Post
    Oh not to mention genes can become attached to others on a different loci. Do a little more research.
    I do not need to do a little more research. Two genes cannot "fuse in to one" as Kevin claims happened with the HGW and Granite


    Quote Originally Posted by TessadasExotics View Post
    He was the one that wants to attack… Hmm im pretty sure he was the one who started being rude/insulting, not I.
    I was not attacking, rude or insulting. At least not by intent and I do apologize if it seemed that way.

    I will say however that you accusing me of wantonly spreading misinformation was more than a little offputting.


    Quote Originally Posted by TessadasExotics View Post
    As far as debating, he's not debating either. Just trying to belittle and over power with his "knowledge". Its all good he can
    I accept the accusation that I am not debating because, frankly, I am not. But I am not belittling and overpowering as a means of getting my kicks in. As I have had to say to many many people before in situations like this: I never claimed to know more than everyone about everything. I know more than some people and I know less than other people. When I know less than someone, my goal is to learn. When I know more than someone I strive to teach. It is just really hard to try and teach someone when they are so set on refusing to listen to anything or consider that just maybe they could learn something.


    Quote Originally Posted by TessadasExotics View Post
    I could care less how much of a genetics expert he thinks to be..
    Quote Originally Posted by Royal Hijinx View Post
    I believe he in fact has a PhD in genetics... so you may want to re-assess your "comfort" with your "knowledge".
    There is a reason my signature reads the way it does. Cheers Jinx
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 12 Users Say Thank You to asplundii For This Useful Post:

    + Show/Hide list of the thanked

    BHReptiles (05-21-2013),Coleslaw007 (05-21-2013),Dave Green (05-21-2013),eatgoodfood (05-21-2013),HypoLyf (05-21-2013),Inarikins (05-21-2013),interloc (05-21-2013),Royal Hijinx (05-21-2013),satomi325 (05-21-2013),snakesRkewl (05-21-2013),STjepkes (05-21-2013),whispersinmyhead (05-21-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1