» Site Navigation
0 members and 1,698 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,102
Threads: 249,247
Posts: 2,572,954
Top Poster: JLC (31,651)
|
-
Re: What are Pieds? (Jinx)
 Originally Posted by TessadasExotics
Just because there can be "markers" (which I might add are not 100%) for a recessive trait does not make it not recessive. They still have the WT phenotype in the het form, which is what makes them recessive.
When you breed a pastel to a normal the pastels you make are not just pastels, they are pastel + whatever genetics the normal adds to the equation.
When you breed a clown X normal the sum total of that snake is whatever both sire and dam bring to the table.
In my opinion what you are saying isn't even possible, both parents add to the out come of every baby,
so how is it even possible to say only one trait shows?
Because early pioneers in the hobby said so?
I was always taught to question everything, so that don't fly with me.
Back to my photo's, I asked if het clown is truly recessive how does it alter those yellowbellys 100% of the time.
Jerry Robertson

-
-
Re: What are Pieds? (Jinx)
 Originally Posted by snakesRkewl
When you breed a pastel to a normal the pastels you make are not just pastels, they are pastel + whatever genetics the normal adds to the equation.
When you breed a clown X normal the sum total of that snake is whatever both sire and dam bring to the table.
In my opinion what you are saying isn't even possible, both parents add to the out come of every baby,
so how is it even possible to say only one trait shows?
Because early pioneers in the hobby said so?
I was always taught to question everything, so that don't fly with me.
Back to my photo's, I asked if het clown is truly recessive how does it alter those yellowbellys 100% of the time.
Yes every parent adds to the outcome 99.999999999999% of the time. Where did I say they didn't? It's possible to say that only one trait shows because it is proven genetics. A clown male to a normal female will result in the babies having 1 WT gene and 1 Clown gene. Those babies will NOT look like a clown. They may have "markers" but they DON'T look like a clown. Hence clown is a recessive trait. It is not EXPRESSED in the het form. Like I said just because you can possibly see a marker doesn’t make it not a recessive trait. Not to mention more than one locus that can affect the appearance of an animal.
I to question everything. If I don't know the answer to something I will ask others who do and will also research it.
-
-
guys, calm down.
Maybe you just need to differentiate more between genes andtraits.
You can argue and debate all day, but i think the problem is not to be found in physical reality, the problem is in different imprecise and incompatible descriptions of reality.
There is no difference between a super form and a visible recessive. Its homozygous.
GENES can be absent, or present in heterozygous form, or present in homozygous form. nothing inbetween. If a homozygous form is invisible or absent or lethal, we call the gene dominant. Here you could call genes where the heterozygous form is completely undetectible recessives, but really there is not much of a point to it. Most genes we work with are codominant, some genes are dominant because there is no proven super, a few are recessive because the hets show no markers. But a snake can have each gene 0 times, 1 time, or 2 times.
TRAITS can be incomplete dominant or recessive. Albino is a recessive trait, Ivory is a recessive trait, blue-eye-lucy is a recessive trait, pied is a recessive trait. It doesnt matter that the gene is not recessive here! It just doesnt matter. Albino is a trait, and its described as white/yellow, absence of black pigment. And you need a homozygous or super (remember, these two are the same) to get there. Same for the Ivory. The gene may be clearly codominant, but Ivory is a recessive TRAIT. You need a homozygous super to get it. With pied you need a homozygous recessive to get visual pied, with leopard you need a super leopard to get a pied.
Really, you are fighting meaningless semantics. A deeper knowledge and more precise language causes these meaningless conflicts to simply vanish. You worry about het pieds? think het red axanthic. Visible supers are similar to visible recessives.
-
-
Re: What are Pieds? (Jinx)
 Originally Posted by Kurtilein
guys, calm down.
Maybe you just need to differentiate more between genes andtraits.
You can argue and debate all day, but i think the problem is not to be found in physical reality, the problem is in different imprecise and incompatible descriptions of reality.
There is no difference between a super form and a visible recessive. Its homozygous.
GENES can be absent, or present in heterozygous form, or present in homozygous form. nothing inbetween. If a homozygous form is invisible or absent or lethal, we call the gene dominant. Here you could call genes where the heterozygous form is completely undetectible recessives, but really there is not much of a point to it. Most genes we work with are codominant, some genes are dominant because there is no proven super, a few are recessive because the hets show no markers. But a snake can have each gene 0 times, 1 time, or 2 times.
TRAITS can be incomplete dominant or recessive. Albino is a recessive trait, Ivory is a recessive trait, blue-eye-lucy is a recessive trait, pied is a recessive trait. It doesnt matter that the gene is not recessive here! It just doesnt matter. Albino is a trait, and its described as white/yellow, absence of black pigment. And you need a homozygous or super (remember, these two are the same) to get there. Same for the Ivory. The gene may be clearly codominant, but Ivory is a recessive TRAIT. You need a homozygous super to get it. With pied you need a homozygous recessive to get visual pied, with leopard you need a super leopard to get a pied.
Really, you are fighting meaningless semantics. A deeper knowledge and more precise language causes these meaningless conflicts to simply vanish. You worry about het pieds? think het red axanthic. Visible supers are similar to visible recessives.
Oh I am calm and tranquil. Unfortunately typed letters do not convey emotions, just words.
-
The Following User Says Thank You to TessadasExotics For This Useful Post:
irishanaconda (05-21-2013)
-
Let me add... How about the NERD theory on Granites "attaching" to Hidden Gene Woma? Could this really be true and if so, I could see the Leopard/Pied thing in the same realm of becoming "attached", or they are just Allelic like some have proven them to be, or the original Leopards had already "attached" the pied gene, causing them to be what they are now.
I don't know, but what I do know is that we still have MANY years of figuring this stuff out... like the whole Banana "sex-link" issue... it boggles my mind... there is still much to figure out, holistically.
I agree with asplundii and Brant on their comments.
-
-
Re: What are Pieds? (Jinx)
Yes every parent adds to the outcome 99.999999999999% of the time. Where did I say they didn't? It's possible to say that only one trait shows because it is proven genetics. A clown male to a normal female will result in the babies having 1 WT gene and 1 Clown gene. Those babies will NOT look like a clown. They may have "markers" but they DON'T look like a clown. Hence clown is a recessive trait. It is not EXPRESSED in the het form. Like I said just because you can possibly see a marker doesn’t make it not a recessive trait. Not to mention more than one locus that can affect the appearance of an animal.
I to question everything. If I don't know the answer to something I will ask others who do and will also research it.
No one is saying that the clown gene is expressed as a clown in a het clown animal. What we're saying is that the clown GENE causes a slightly different phenotype than just a plane wild type animal. That phenotype won't be that of a clown animal, but it will be slightly different in the sense that if you were to put 10 normal babies in a tub with one of them being "het clown", just based on how the animal looks, you can pick out that "het clown" with pretty good accuracy.
If you did question everything, then you wouldn't be saying things along the lines of "Just accept that pied and clown are recessive." That's not questioning at all...that's simply conforming to the current paradigm.
-
The Following 4 Users Say Thank You to BHReptiles For This Useful Post:
asplundii (05-21-2013),eatgoodfood (05-21-2013),satomi325 (05-20-2013),STjepkes (05-20-2013)
-
Re: What are Pieds? (Jinx)
 Originally Posted by Coopers Constrictors
Let me add... How about the NERD theory on Granites "attaching" to Hidden Gene Woma? Could this really be true and if so, I could see the Leopard/Pied thing in the same realm of becoming "attached", or they are just Allelic like some have proven them to be, or the original Leopards had already "attached" the pied gene, causing them to be what they are now.
I don't know, but what I do know is that we still have MANY years of figuring this stuff out... like the whole Banana "sex-link" issue... it boggles my mind... there is still much to figure out, holistically.
I agree with asplundii and Brant on their comments.
Leopard and het pied are really just allelic. if you make a super leopard, it looks like a pied. Same if you make a homozygous pied. And same for the combination: one copy of leopard and one copy of het pied also looks pied. These are the only known combos that make a visible pied. So its just like with BEL, or albino /candy / toffee.
That two genes are difficult to combine and once combined difficult to seperate is possible, that means they are close together on the same chromosome. But NERD uses confusing language when talking about genetics, its often hard to interpret unless you already have the correct answer. When it comes to genetics, i doubt anything coming from NERD unless properly proven out by others as well. And hidden gene woma, i dont know, a weird gene with a lethal super that has the wobble.
I think the issue with banana / coral glow is properly figured out by now, it just sits on the sex-determining chromosome pair. "ww" is a male and "wz" is a female. If all the "w"s in your BP carry the coral glow gene, you get a visual coral glow. It sits on the "w", and the presence of a "z" makes your python female. Basically its like a recessive, except in females you get one for free. So male coral glows are a bit harder to produce and a bit more powerful, and you can get pairings where in the offspring all males look normal and all females are visual coral glows. Its not too difficult really.
-
The Following User Says Thank You to Pythonfriend For This Useful Post:
-
Re: What are Pieds? (Jinx)
Spider 100% het clown with pretty much no white sides from a high white blonde bumblebee that has thrown nothing but high white otherwise

It's pretty well known that adding het clown to spider causes low white to no white sides,
odd thing for a recessive trait to do don't you think?
It displays itself quite well in all morphs but not the wild type gene, how odd
Jerry Robertson

-
The Following 2 Users Say Thank You to snakesRkewl For This Useful Post:
majorleaguereptiles (05-21-2013),STjepkes (05-20-2013)
-
Re: What are Pieds? (Jinx)
 Originally Posted by creepin
makes sense. so i guess my question now would be.. if WT phenotype het clowns were indistinguishable from their 100% WT counterparts, yet one was able to pick out pastel or YB het clowns from other pastel, YB, or whatever non-hets, would you then consider the clown mutation incomplete dominant or recessive?
Hey Creepin,
The argument is that the het Clowns are distinguishable from their WT siblings, just that in an otherwise WT background the difference is subtle enough that it might be missed by those with the untrained eye. And yes it is still considered inc-dom because that designation applies to the “three-phenotype rule” as it relates to the allele pair regardless of the background.
 Originally Posted by TessadasExotics
Actually I understand genetics quite a bit more than most people here.
 Originally Posted by TessadasExotics
I do fortunately understand quite a bit about genetics. I also do not rely on wiki for my knowledge.
No, you do not understand genetics, you only think you do. Really, you know just enough about genetics to think you know what you are talking about and that is just getting you in to trouble. Everything you are saying proves that you have a fundamental lack of understanding about how genetics works.
And yes, you are relying on Wiki because you keep citing that as the source of your knowledge.
 Originally Posted by TessadasExotics
You say they are and it is commonly accepted so, but this does not make it so. Again I refer you to look into other animals such as mice, fish or even birds. Maybe what we are really dealing with is transheterozygotes
Yes, please do look at piebaldism in other species… Know what you will find? That in other species that exhibit the trait it is incomplete-dominant. And the same thing applies for leucism.
 Originally Posted by TessadasExotics
My proclaiming came into this because it IS a discussion on such things. And for the simple reason that it IS fact that Albinos, Clowns, Hypos and even Pieds are recessive.
Albinos? Yes (with the possible exception of that one allele Brant mentioned.) Hypos? Sure. Clowns? Looks like they may be inc-dom, maybe not, I still think some work needs to be done. Pieds? Inc-dom all the way.
But all of that is beside the point. The point I was making is that you come in here and say that none of us know what we are talking about and that we just need to shut up and quit making things worse when you are the one who is spouting off wrong/incorrect information because you are misinformed and highly overconfident in your own knowledge. We are not the ones making things worse.
 Originally Posted by TessadasExotics
What makes them recessive is that their het phenotype is the normal wild type appearance and their hom phenotype is the said morph appearance.
Except that Pieds hets have an altered phenotype when in heteroallelic form and a second phenotype when in homoallelic form which makes them incomplete-dominant. Their het phenotype is not WT.
 Originally Posted by TessadasExotics
Actually it is only visible when it is Homozygous.
Oops, typo. My fingers and brain seem to have miscommunicated. I can own my mistake though. However, my example citation makes it clear what I meant
 Originally Posted by TessadasExotics
This is a poor way to try and describe a dominant phenotype as Albino is a proven recessive trait.
I am not talking about the Albino allele I am talking about the WT allele at the tyr locus. Yes, Albino is recessive, I said that in the example right above this. But something is only recessive in relation to another allele, in this case the WT allele. So actually this is the perfect example because it shows how a dominant genetic trait works; one copy or two copies, the phenotype is the same.
 Originally Posted by TessadasExotics
I feel that this also is a bad example to use, as I feel that the whole BEL complex is being over simplified.
You can feel whatever you want, it does not change the truth. The BluEL complex is not being “over simplified” here but if you do not like it then substitute the BlkEL allele group. Or SuperBlack allele group. Or the StripeBack allele group. Or the Pastel allele group. Or the Paint allele group. Or the Chocolate allele group. Or Enchi. Or Orange Dream... They all behave the same; one copy of the mutant gene gives phenotype A and two copies of the mutant gene gives phenotype B. The very definition of incomplete-dominance.
I am not sure how anyone could claim they are recessive. And yet you do...
 Originally Posted by TessadasExotics
A clown male to a normal female will result in the babies having 1 WT gene and 1 Clown gene. Those babies will NOT look like a clown. They may have "markers" but they DON'T look like a clown. Hence clown is a recessive trait. It is not EXPRESSED in the het form. Like I said just because you can possibly see a marker doesn’t make it not a recessive trait. Not to mention more than one locus that can affect the appearance of an animal.
[QUOTE=BHReptiles;2075317]No one is saying that the clown gene is expressed as a clown in a het clown animal. What we're saying is that the clown GENE causes a slightly different phenotype than just a plane wild type animal. That phenotype won't be that of a clown animal, but it will be slightly different in the sense that if you were to put 10 normal babies in a tub with one of them being "het clown", just based on how the animal looks, you can pick out that "het clown" with pretty good accuracy.[QUOTE]
Just so BHR. 
This whole argument that “het Clown has to look like a Clown” or “het Pied has to look like a Pied” proves they are recessive once again highlights your lack of understanding of genetics. For something to be recessive the het has to have a phenotype no different than the WT. Pied hets do have a phenotype different than WT. All Pied hets. Clown hets also appear to have this difference. The point being that because there is a different phenotype, however subtle, that is proof that they are not recessive. The heteroallelic does not have to look like the homoallelic, in point of fact it cannot because then it would be a strictly dominant gene. And no one is saying that
 Originally Posted by TessadasExotics
I to question everything. If I don't know the answer to something I will ask others who do and will also research it.
 Originally Posted by BHReptiles
If you did question everything, then you wouldn't be saying things along the lines of "Just accept that pied and clown are recessive." That's not questioning at all...that's simply conforming to the current paradigm.
I could not have said it better myself BHR
 Originally Posted by Kurtilein
Most genes we work with are codominant, some genes are dominant because there is no proven super, a few are recessive because the hets show no markers.
Ummm… No… Most of the genes we work with are inc-dom. There are, as yet, no proven dominant morphs and no proven co-dominant morphs.
 Originally Posted by Coopers Constrictors
Let me add... How about the NERD theory on Granites "attaching" to Hidden Gene Woma? Could this really be true and if so, I could see the Leopard/Pied thing in the same realm of becoming "attached", or they are just Allelic like some have proven them to be, or the original Leopards had already "attached" the pied gene, causing them to be what they are now.
This is another great case of misinterpretation getting perpetuated along. Genes cannot “attach” to one another. Granite and HGW are not attached and the belief that the “neck-spot” proves an HGW is also a Granite is fallacious.
 Originally Posted by Coopers Constrictors
I don't know, but what I do know is that we still have MANY years of figuring this stuff out... like the whole Banana "sex-link" issue... it boggles my mind... there is still much to figure out, holistically.
 Originally Posted by Kurtilein
I think the issue with banana / coral glow is properly figured out by now, it just sits on the sex-determining chromosome pair. "ww" is a male and "wz" is a female. If all the "w"s in your BP carry the coral glow gene, you get a visual coral glow. It sits on the "w", and the presence of a "z" makes your python female. Basically its like a recessive, except in females you get one for free. So male coral glows are a bit harder to produce and a bit more powerful, and you can get pairings where in the offspring all males look normal and all females are visual coral glows. Its not too difficult really.
NO NO NO NO NO NO NO NO NO!!!!!!!!!
Please follow your own words here:
 Originally Posted by Kurtilein
When it comes to genetics, i doubt anything coming from NERD unless properly proven out by others as well. And hidden gene woma, i dont know, a weird gene with a lethal super that has the wobble.
Banana/CG are not, in any way, shape or form sex-linked. I really do not have the time to go in to all the nitty-gritty on it but draw out the Punnett squares and you will see that the actual breeding results do not match what we should see of a sex-linked trait. I am not saying there is not something weird going on with Banana/CG but it is not sex-linked!
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 7 Users Say Thank You to asplundii For This Useful Post:
BHReptiles (05-21-2013),cassafras (05-21-2013),Coleslaw007 (05-21-2013),eatgoodfood (05-21-2013),Inarikins (05-21-2013),satomi325 (05-21-2013),snakesRkewl (05-21-2013)
-
Look im done with your silly argument. You fail to grasp a simple concept of simpOre recessive. Pied is known for being recessive in all other animals as well as leucism. Just because you say its so, despite all other data is not the defining correct answer. I keep referring to wiki. Um yeah ok. I guess copying/pasting one (1) definition from a simple definition of recessive makes this so right.
Here let me break it down for you again. In. Albino sumple recessive. Pied simple recessive. Clown simple recessive. Hypo simple recessive. Genetic stripe simple recessive. Genes can have an influence on other genes. The genes we are working with in ball pythons are on more than just one locus. One locus can affect another. Just because you may be able to pick out a pastel het clown still does not make it not a recessive trait. Breedings of these mutarions prove without a doubt that they are simple recessive yet you continue to say otherwise. Go ahead and keep missinforning others. This hobby is already missinformed as it is.
Its going to be funny when some people will start saying the breed codom clowns. Or seeing the look on breeders faces when someone tells them that their pied is codom.
The other thing I find funny. With my so called lack of knowledge on genetics. You have always agreed with what I have had to say before and now all of a sudden I dont have a clue about what im talking about.
Enjoy your codom clowns.
-
The Following User Says Thank You to TessadasExotics For This Useful Post:
irishanaconda (05-21-2013)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|