Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 711

0 members and 711 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,113
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 153

Threaded View

  1. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by creepin View Post
    it is my understanding (granted i am a mere "reader") that the wild type looking hets are just that: of the wild type phenotype.. and for a gene to be considered incomplete dominant (completely eliminating all other variables such as other genes), when it carries only one of the genes, you don't have a wild type phenotype. i understand that many people claim they can pick out pastel het clowns, but i havent seen this claim made with "normal" het clowns, at least not often.. but it's also a good possibility i haven't read enough. can WT phenotype clown or hypo hets be picked out with any sort of accuracy? if so, then we shouldn't consider them a WT phenotype at all, and if not, would they not still be considered recessive since a WT looking snake that is het for the gene still has a normal phenotype, regardless of how that single gene may affect the appearance of a snake that already has a not so normal phenotype?

    Creepin'

    It is like I said in my post in reference to Brant's comment about breeding to a super form:

    Quote Originally Posted by asplundii View Post
    ... it does not mean that there is no heterozygous effect you breed to a normal, only that the effect in normals is often very very subtle but when bred to a super that effect becomes much more apparent.
    If you know what you are looking for you can pick the hets from the non-hets in a WT breeding, the difference is there, it is just that it is very subtle. At least as far as Pied goes. As I noted above, I have not been looking in to Clowns as much so I cannot say the same with any high level of confidence for them.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    TheSnakeGeek (05-20-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1