Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,078

1 members and 1,077 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,124
Threads: 249,269
Posts: 2,573,103
Top Poster: JLC (31,651)
Welcome to our newest member, Wormsmama
Page 9 of 16 FirstFirst 12345678910111213141516 LastLast
Results 81 to 90 of 153
  1. #81
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by GPreptiles View Post
    Great thread, lots of information here . Keep it up please .

    Can someone of the experienced guys point out what to look for if I want to pick a het clown out of a pile of babies? I mean I think there is a change in colors as we can see on the pictures and also a slight change in pattern. Anything else apart from those two signs? I know it's hard to describe and it's easier to show an example, that's why it's easier to pick a het from a group, then tell by looking at an individual animal .
    As I said earlier, it's much easier to identify these when have a solid base. Like Travis said a WT (wild type) aka a normal. Sibling comparison is really great not only for these hets, but even when trying to identify combos. I get texts from many experienced breeders asking "hey brant what do you see?" While I'm pretty good at seeing stuff, I need the base to make good decisions. Whether its other genes, other combos in the clutch, etc.

    I was asked how could you tell you hatched an epic pastel yb vs. a pastel yb. If i didn't hatch a pastel yb in the same clutch with an epic pastel yb, I honestly probably couldn't tell you with certainty, other than basing my decision on other examples outside the immediate genepool within the clutch. As we know with genetic variation it can be difficult to do so. Thats why a solid base within the clutch is really the base way to train the eye on genetic mutations.

    I mentioned previously about using super forms when identifying hets because what it would do is give the base to analyze the difference. Going through 40,000 imports, its not like I'm going to pull out a het clown from a group of ball pythons. As we know WT have genetic variation. Again, normals have their own genetics. In cases when identifying these subtle hets, its important to have the background and clutch base to really make the decision.

    Last season I bred an Arroyo (het rio). Dan Wolfe and I discussed how he previously named them het rios because they weren't nearly as visual as the Rio (obviously). However, after closer analysis, we both agreed that identifying hets were far too easy. Especially in combo form. So the morph was changed to inc-dom and the hets were renamed Arroyo. Honestly, to someone close-minded they would receive an arroyo and probably say, it just looks like a fancy normal. Which without knowing the base, is actually a good analysis. However, it doesn't change the fact that I can easily identify them within a clutch of arroyo x normal. So it would be pretty foolish to sell an identifiable inc-dom mutation and call them hets. Would make it simple for someone like me, who did purchase an Arroyo (het Rio), to breed it out, and raise up arroyo females to make the fantastic Rio. That is really why the pricing schematics changed within the project as well. Instead of pricing a project as a recessive, it's priced as a co-dom which is actually a large difference.

    These are just some examples I wanted to share and discuss how important the base is when identifying morphs and combos. It's why I love large clutches when I'm trying to figure out genetics. It gives me the large base I'm looking for to break it down accurately. Thats why sometimes multiple clutches are needed to figure things out.

  2. The Following 5 Users Say Thank You to majorleaguereptiles For This Useful Post:

    BHReptiles (05-22-2013),GPreptiles (05-21-2013),Royal Hijinx (05-22-2013),satomi325 (05-21-2013),Slowcountry Balls (05-21-2013)

  3. #82
    BPnet Veteran TessadasExotics's Avatar
    Join Date
    03-05-2010
    Location
    CT
    Posts
    1,642
    Thanks
    202
    Thanked 466 Times in 397 Posts
    Images: 214

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by majorleaguereptiles View Post
    As I said earlier, it's much easier to identify these when have a solid base. Like Travis said a WT (wild type) aka a normal. Sibling comparison is really great not only for these hets, but even when trying to identify combos. I get texts from many experienced breeders asking "hey brant what do you see?" While I'm pretty good at seeing stuff, I need the base to make good decisions. Whether its other genes, other combos in the clutch, etc.

    I was asked how could you tell you hatched an epic pastel yb vs. a pastel yb. If i didn't hatch a pastel yb in the same clutch with an epic pastel yb, I honestly probably couldn't tell you with certainty, other than basing my decision on other examples outside the immediate genepool within the clutch. As we know with genetic variation it can be difficult to do so. Thats why a solid base within the clutch is really the base way to train the eye on genetic mutations.

    I mentioned previously about using super forms when identifying hets because what it would do is give the base to analyze the difference. Going through 40,000 imports, its not like I'm going to pull out a het clown from a group of ball pythons. As we know WT have genetic variation. Again, normals have their own genetics. In cases when identifying these subtle hets, its important to have the background and clutch base to really make the decision.

    Last season I bred an Arroyo (het rio). Dan Wolfe and I discussed how he previously named them het rios because they weren't nearly as visual as the Rio (obviously). However, after closer analysis, we both agreed that identifying hets were far too easy. Especially in combo form. So the morph was changed to inc-dom and the hets were renamed Arroyo. Honestly, to someone close-minded they would receive an arroyo and probably say, it just looks like a fancy normal. Which without knowing the base, is actually a good analysis. However, it doesn't change the fact that I can easily identify them within a clutch of arroyo x normal. So it would be pretty foolish to sell an identifiable inc-dom mutation and call them hets. Would make it simple for someone like me, who did purchase an Arroyo (het Rio), to breed it out, and raise up arroyo females to make the fantastic Rio. That is really why the pricing schematics changed within the project as well. Instead of pricing a project as a recessive, it's priced as a co-dom which is actually a large difference.

    These are just some examples I wanted to share and discuss how important the base is when identifying morphs and combos. It's why I love large clutches when I'm trying to figure out genetics. It gives me the large base I'm looking for to break it down accurately. Thats why sometimes multiple clutches are needed to figure things out.


    Prime example. You can NOT pick out het pieds, het clowns or any other recessive trait just by markers. If you are working with a known recessive phenotype then yes it can be possible with some experience. This does not make them incomplete dominant. Like I said I can pick het lavs from our clutches. So they are not recessive? I can do the same with our hypo clutches. Are they not recessive?
    Lotsa Balls and more

    http://www.tessadasexotics.com/

  4. #83
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    What are Pieds? (Jinx)

    Quote Originally Posted by TessadasExotics View Post
    Prime example. You can NOT pick out het pieds, het clowns or any other recessive trait just by markers. If you are working with a known recessive phenotype then yes it can be possible with some experience. This does not make them incomplete dominant. Like I said I can pick het lavs from our clutches. So they are not recessive? I can do the same with our hypo clutches. Are they not recessive?
    As I said before, every ball python is genetic. Therefore it would make it hard to pick out a het from a wt when the base is 40,000.
    I couldn't 100% pick out an arroyo either from imports and its inc-Dom. And to be honest, I might be able to pick out a het pied, but again it wouldn't be 100% without the accurate base comparison.

    However, that absolutely doesn't mean it's recessive. I don't know why you are so firm on your interpretation.

  5. #84
    BPnet Veteran majorleaguereptiles's Avatar
    Join Date
    11-18-2010
    Location
    San Diego, CA
    Posts
    391
    Thanks
    38
    Thanked 288 Times in 127 Posts

    What are Pieds? (Jinx)

    Quote Originally Posted by TessadasExotics View Post
    If you are working with a known recessive phenotype then yes it can be possible with some experience.
    Exactly!

  6. The Following 3 Users Say Thank You to majorleaguereptiles For This Useful Post:

    BHReptiles (05-22-2013),Mike41793 (05-21-2013),snakesRkewl (05-21-2013)

  7. #85
    BPnet Senior Member
    Join Date
    09-20-2012
    Location
    Mid. TN
    Posts
    1,634
    Thanks
    404
    Thanked 1,155 Times in 615 Posts

    What are Pieds? (Jinx)

    around and around we go. maybe it's finally time to just agree to disagree.

  8. The Following User Says Thank You to TheSnakeGeek For This Useful Post:

    Coleslaw007 (05-21-2013)

  9. #86
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are Pieds? (Jinx)

    Quote Originally Posted by foobar View Post
    However, coming from the 01 industry (IT), I'm not that happy with the actual naming. Since it leads to misunderstanding. I know, one might say that doesn't matter if I'm happy or not, definitely true, but I think there is the crux of the matter.

    Dominant -> Rules over something
    Recessive -> Stands back for something

    Considering this two words, I can't see how the gene(s) responsible for piebald can be incomplete dominant. I actually see the point and agree that genes showing up in heterozygous form can't be simple recessive, at least not in a manner as we used to use the term.



    But that isn't the case on all those genes that we're talking about here. As long as a few are able to pick those heterozygous animals, meaning, as long as there is something in the phenotype to distinguish those from wildtype animals, there is a need for another word in my opinion. They're too subtle to be any sort of dominant. I rather would see the term incomplete/partial recessive, since it is closer to be recessive than dominant. But better something new. Maybe it is time for something new?
    Hey Foo,

    I see what you are driving at here and I think part of your… dislike… may stem from you being an IT guy. But first, let me address this comment and then I will come back:

    Quote Originally Posted by foobar View Post
    But anyway, I still think incomplete dominant is a washy term and would rather stick to intermediate inheritance.
    Like it or not this term is an established on in the field of genetics. So you cannot just decide to scrap it and come up with something better. Sorry.


    No, back to the earlier point. I think that the reason this seems a bit muddled is because, as an IT-type, you are accustomed to thinking 1 and 0, yes and no. You even illustrate this with your breakdown of dominant and recessive

    Dominant -> Rules over something -> 1
    Recessive -> Stands back for something -> 0

    Genetics is not quite as neat and tidy as binary. But if you can approach the problem like this it might make a bit more sense for inc-dom:

    Dominant -> 1
    Incomplete Dominant -> any value between 0 and 1
    Recessive -> 0

    So if something has a value of 0.0000000000001 even though it is very minute, it still has a value greater than 0 so it “rules over” 0. But it is also less than 1 so it does not “absolutely” rule over

    And if something has a value of 0.5 there is now a significant value greater than 0 while still being less than the “absolute” rule of 1

    Putting it all back in to morph terms… A value of 0.8 would apply to a morph like Lesser. For a BlackPastel you might put it at 0.6 on the scale. YellowBelly probably falls at around 0.3 or 0.25. Pied might hit 0.1, maybe a little higher depending on who you talk to.


    Quote Originally Posted by irishanaconda View Post
    Im on the other side of the fence... i dont agree but hey... its all good. I think certain lines of recessive have been line bred to better looking snakes in the long run that throw better looking markers. But i don't feel as if it can be generalized for the whole gene. My opinion
    Fair enough Irish, and with some morphs, to some extent, I can even agree with you.


    Quote Originally Posted by eatgoodfood View Post
    Line breeding or not, if there are 'markers' then it is phenotypically different than a wild type.
    I disagree with this… Line breeding is not a consistent thing because any one persons selective criteria are going to be different than any other persons so line breeding is not inherently/consistently stable. A true, phenotypic difference cause by the single gene in question is stable.


    Quote Originally Posted by TessadasExotics View Post
    I am aware that Travis has a Phd. He says so in his signature. He may think I do not understand genetics beyond wiki yet he is incorrect.
    Okay, let me try this…

    Tessa, I did not say you did not understand genetics beyond Wiki but obviously you take great offense to my making the Wiki comment and so I apologize.


    That said, I stand by my statement that you are not as fluent in genetics as you believe yourself to be. That is not said as an insult and I dearly wish you would recognize that. A person cannot learn until they recognize their limitations. To someone as well versed in genetics as myself, I can see that you are confused/mistaken/mislead/whatever descriptive will not piss you off further.

    Look at it like this; when I take my car to the garage to get it worked on, if I tell the mechanic I think the problem is X but after examining the car my mechanic tells me that it is actually problem Y, how successfully is my car going to be repaired if I tell him, I know all I need to know so just fix X and be done with it??


    Quote Originally Posted by majorleaguereptiles View Post
    Going through 40,000 imports, its not like I'm going to pull out a het clown from a group of ball pythons. As we know WT have genetic variation. Again, normals have their own genetics. In cases when identifying these subtle hets, its important to have the background and clutch base to really make the decision.
    This right here is why I am not fully convinced on the Clown thing. I think if I were to take a bunch of known het Pieds and mix them in with a bunch of normal that the hets could be ID’d without much fuss. I have not seen enough het Clowns hands on to feel the same experiment would be as easy. And I have yet to see compelling proof that the same feat can be executed reliably with any of the other recessives.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #87
    BPnet Senior Member Don's Avatar
    Join Date
    10-03-2007
    Location
    Richmond, Viginia
    Posts
    1,675
    Thanks
    502
    Thanked 842 Times in 542 Posts
    Images: 7
    I think it is going to take a lot more discussion before breeders start selling het pieds as pieds and pieds as super pieds. It can get very confusing because terminology (whether correct or wrong) has been established and recognized in the community.

    Next we will discuss the pronunciation of the word Leucistic. I've rarely heard it pronounced properly in the herp community. And, yes - I do know how to say it correctly.

  11. The Following User Says Thank You to Don For This Useful Post:

    Coleslaw007 (05-21-2013)

  12. #88
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,982 Times in 5,584 Posts

    What are Pieds? (Jinx)

    Quote Originally Posted by Don View Post
    Next we will discuss the pronunciation of the word Leucistic. I've rarely heard it pronounced properly in the herp community. And, yes - I do know how to say it correctly.
    Both ways are considered ok. I've debated this with someone before lol. I understand and probably agree that the "k" sound is more correct, but lu-sis-stick is how oxford dictionary (and other legitimate sources) say to pronounce it.
    1.0 normal bp

  13. The Following User Says Thank You to Mike41793 For This Useful Post:

    Coleslaw007 (05-21-2013)

  14. #89
    BPnet Veteran TessadasExotics's Avatar
    Join Date
    03-05-2010
    Location
    CT
    Posts
    1,642
    Thanks
    202
    Thanked 466 Times in 397 Posts
    Images: 214
    I do understand genetics and my knowledge is not that limited. Despite what you may feel.

    Now by your example/interpritation of why a pied is not recessive..... I can pick out our het lavs and our het hypos from our hatchlings. Does this make them non recessive? How about people who can pick out their het albinos? Im sorry but just because a pied allele can slightly influence the het snake WT allele does not rule it out as not a recessive trait. Another example. And understand I am not talking about added mutations I am talking WT. Many WT show the het pied markers yet they are in fact not het pied. That being said if I took 1 or 2 hetppieds and put them with 20 WT snakes, do you honestly think that you can positively identify those 1 or 2 het pieds from out of the group? I think not. Sorry but I dont buy it.
    Lotsa Balls and more

    http://www.tessadasexotics.com/

  15. #90
    BPnet Veteran satomi325's Avatar
    Join Date
    08-15-2011
    Location
    In a galaxy far,far away.
    Posts
    6,423
    Thanks
    2,429
    Thanked 3,969 Times in 2,446 Posts
    Images: 5

    Re: What are Pieds? (Jinx)

    I think these are great examples of het clown altering the phenotype of normals and morphs:


    66% het clowns w/ clown from Cypress Creek Reps:


    100% het clowns:


    Super Pastel 100% het clown (hooblah's img)





    Quote Originally Posted by Mike41793 View Post
    Both ways are considered ok. I've debated this with someone before lol. I understand and probably agree that the "k" sound is more correct, but lu-sis-stick is how oxford dictionary (and other legitimate sources) say to pronounce it.
    I've always pronouced it 'lu-sis-stick'. I didn't realize people pronounced it different..
    Last edited by satomi325; 05-21-2013 at 07:47 PM.

Page 9 of 16 FirstFirst 12345678910111213141516 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1