» Site Navigation
1 members and 1,692 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,811
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: the only dumb question.....
 Originally Posted by asplundii
Hey Pirate,
I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.
As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)
I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.
I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.
And I'd love to hear more about what you and Greg were working at/on
Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.
-
The Following User Says Thank You to GenePirate For This Useful Post:
-
Re: the only dumb question.....
Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: the only dumb question.....
I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"
Thanks guys!
-
The Following 3 Users Say Thank You to kc261 For This Useful Post:
asplundii (06-15-2009),GenePirate (06-12-2009),scutechute (06-15-2009)
-
Re: the only dumb question.....
 Originally Posted by tonkatoyman
That was clear as mud but it does cover the ground  However I'm so glad there are people out there researching our industry. This can only be good for all of us. By the way you already bent my brain 
Sorry I bent your brain and was clear as mud, I do tend to lapse into jargon when I am talking with someone who is in my field.
I can work to keep it at a more layman level if you like.
 Originally Posted by kc261
I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"
Thanks guys!
Always glad to hear that people appreciate the deep stuff even if it is a little jargon filled. Thanks 
 Originally Posted by GenePirate
Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.
Well, I thought on it and I did not come up with a lot more. Considering all the types of albino (T- and all the different T+) I am leaning more toward my speculation that there is some character of the BP melanin itself that lends to the overall reddish tint on the animals. I do not know how best to articulate my reasoning but the lack of any red cast in the T- albino but the obvious purple/red hue to the various T+ albinos just makes me lean toward that being the most likely explanation.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: the only dumb question.....
 Originally Posted by Spaniard
Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
Head-o-phores--that's classic! LOL I won't soon forget that one!
-
-
Re: the only dumb question.....
i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?
-
-
Re: the only dumb question.....
My book is in my desk at work, so when I get in on monday I will look through it and see. Nothing in detail, that much I can remember. Its a beautiful book though lots of great pictures and good information. Well worth the $75 bucks IMO.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: the only dumb question.....
 Originally Posted by Lucas339
i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?
Hey Lucas,
I checked my book and they do not go over how the pigmentation is expressed in morphs. They do you a couple pages worth of information on melanophores, xanthophores, and iridophores.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|