Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,693

1 members and 1,692 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,811
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Results 1 to 10 of 16

Hybrid View

  1. #1
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: the only dumb question.....

    Quote Originally Posted by asplundii View Post
    Hey Pirate,

    I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.

    As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)

    I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.

    I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.

    And I'd love to hear more about what you and Greg were working at/on
    Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.

  2. The Following User Says Thank You to GenePirate For This Useful Post:

    asplundii (06-15-2009)

  3. #2
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: the only dumb question.....

    Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  4. #3
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: the only dumb question.....

    I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"

    Thanks guys!
    Casey

  5. The Following 3 Users Say Thank You to kc261 For This Useful Post:

    asplundii (06-15-2009),GenePirate (06-12-2009),scutechute (06-15-2009)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: the only dumb question.....

    Quote Originally Posted by tonkatoyman View Post
    That was clear as mud but it does cover the ground However I'm so glad there are people out there researching our industry. This can only be good for all of us. By the way you already bent my brain
    Sorry I bent your brain and was clear as mud, I do tend to lapse into jargon when I am talking with someone who is in my field.

    I can work to keep it at a more layman level if you like.

    Quote Originally Posted by kc261 View Post
    I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"

    Thanks guys!
    Always glad to hear that people appreciate the deep stuff even if it is a little jargon filled. Thanks

    Quote Originally Posted by GenePirate View Post
    Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.
    Well, I thought on it and I did not come up with a lot more. Considering all the types of albino (T- and all the different T+) I am leaning more toward my speculation that there is some character of the BP melanin itself that lends to the overall reddish tint on the animals. I do not know how best to articulate my reasoning but the lack of any red cast in the T- albino but the obvious purple/red hue to the various T+ albinos just makes me lean toward that being the most likely explanation.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. #5
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: the only dumb question.....

    Quote Originally Posted by Spaniard View Post
    Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
    Head-o-phores--that's classic! LOL I won't soon forget that one!

  8. #6
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: the only dumb question.....

    i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?

  9. #7
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: the only dumb question.....

    My book is in my desk at work, so when I get in on monday I will look through it and see. Nothing in detail, that much I can remember. Its a beautiful book though lots of great pictures and good information. Well worth the $75 bucks IMO.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  10. #8
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: the only dumb question.....

    Quote Originally Posted by Lucas339 View Post
    i need to pick up this VPI book. does it cover pigmentation and how its expressed in the different morphs?
    Hey Lucas,

    I checked my book and they do not go over how the pigmentation is expressed in morphs. They do you a couple pages worth of information on melanophores, xanthophores, and iridophores.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1