Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,769

0 members and 1,769 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,111
Threads: 249,260
Posts: 2,573,015
Top Poster: JLC (31,651)
Welcome to our newest member, MittieParris8
Results 1 to 10 of 16

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: the only dumb question.....

    Hey Pirate,

    I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.

    As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)

    I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.

    I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.

    And I'd love to hear more about what you and Greg were working at/on
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    kc261 (06-12-2009),Lucas339 (06-12-2009),Tikall (06-15-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1