Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 676

0 members and 676 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 1 of 2 12 LastLast
Results 1 to 10 of 16
  1. #1
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    the only dumb question.....

    is the one you don't ask!!

    why do they call it axanthic and not anery when talking about ball pythons?

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: the only dumb question.....

    Because ball pythons have the yellow xanthophores and not the red/orange erythrophores
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. #3
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: the only dumb question.....

    Quote Originally Posted by asplundii View Post
    Because ball pythons have the yellow xanthophores and not the red/orange erythrophores
    Hey, Doc...long time. Do you think its possible that pteridine pigments and carotinoids, because they can be found in the same organelle, may both be present in ball pythons but at much differing concentrations so that the red/orange is masked by an abundance of xanthin (and melanin)? I'm just wondering where the reddish brown hues come from. Because the pigments (pteridine and carotine) are found together in organelles of many species of snake, might a gene that knocks out xanthism also knock out erythrism? And if erythrophores are in small supply, would their visual detection be almost negligible? Just speculation, but I know that you could provide some insight on this.

  4. The Following User Says Thank You to GenePirate For This Useful Post:

    kc261 (06-12-2009)

  5. #4
    BPnet Veteran
    Join Date
    04-11-2009
    Location
    Orlando,Fl
    Posts
    474
    Thanks
    56
    Thanked 92 Times in 84 Posts

    Re: the only dumb question.....

    that made my head hurt,,,,answer in short,,,thats just how it,,because they said so,,,,
    1.0 blonde pastel,1.8 normal,1.1 het orange ghost 1.0 het butterscotch 0.1 het green ghost 0.1 het albino 0.1 rtb 0.1 yellow anaconda 1.0 borneo blood 1.0 albino burmese

  6. #5
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: the only dumb question.....

    Quote Originally Posted by Lucas339 View Post
    is the one you don't ask!!

    why do they call it axanthic and not anery when talking about ball pythons?
    This is an excellent question. Glad you asked. I don't think the answer is as easy as it seems.

    Quote Originally Posted by RebelYell83 View Post
    that made my head hurt,,,,answer in short,,,thats just how it,,because they said so,,,,
    Sorry, Rebel, didn't mean to kill your Friday. This is a topic that I started working on with Greg Graziani a year or so ago, but I dropped the ball because I got overwhelmed in trying to find contract electron microscopy laboratories that didn't charge a "caramel glow" for a couple of pics. Actually, its not THAT expensive, but still beyond my budget right now.

  7. The Following User Says Thank You to GenePirate For This Useful Post:

    Lucas339 (06-12-2009)

  8. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: the only dumb question.....

    Hey Pirate,

    I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.

    As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)

    I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.

    I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.

    And I'd love to hear more about what you and Greg were working at/on
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    kc261 (06-12-2009),Lucas339 (06-12-2009),Tikall (06-15-2009)

  10. #7
    BPnet Veteran tonkatoyman's Avatar
    Join Date
    05-15-2009
    Location
    Mississippi
    Posts
    792
    Thanks
    157
    Thanked 318 Times in 240 Posts

    Re: the only dumb question.....

    Quote Originally Posted by asplundii View Post
    Hey Pirate,

    I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.

    As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)

    I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.

    I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.

    And I'd love to hear more about what you and Greg were working at/on

    That was clear as mud but it does cover the ground However I'm so glad there are people out there researching our industry. This can only be good for all of us. By the way you already bent my brain

  11. #8
    BPnet Veteran GenePirate's Avatar
    Join Date
    04-11-2009
    Location
    Coastal South Carolina
    Posts
    249
    Thanks
    92
    Thanked 101 Times in 73 Posts
    Images: 8

    Re: the only dumb question.....

    Quote Originally Posted by asplundii View Post
    Hey Pirate,

    I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.

    As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)

    I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.

    I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.

    And I'd love to hear more about what you and Greg were working at/on
    Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.

  12. The Following User Says Thank You to GenePirate For This Useful Post:

    asplundii (06-15-2009)

  13. #9
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: the only dumb question.....

    Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  14. #10
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: the only dumb question.....

    I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"

    Thanks guys!
    Casey

  15. The Following 3 Users Say Thank You to kc261 For This Useful Post:

    asplundii (06-15-2009),GenePirate (06-12-2009),scutechute (06-15-2009)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1