» Site Navigation
0 members and 1,410 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
|
-
Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by Kurtilein
Evolutionary it is true that it is significant if different genes sit on the same locus (same location on the same chromosome), and when genes just sit on the same chromosome but far apart from each other, it doesnt matter much because crossovers between chromosomes do happen. But evolution has time, millions of indviduals, millions of years. For us BP breeders, it does make a difference if two genes are on one chromosome or not.
It does make a difference and then again it does not make a difference.
As this thread is progressing it is becoming more obvious to me that you are basically driving at linkage. Once upon a time I had a slide deck worked out for this, I will see if I can 1) find it, 2) upload it and 3) post it, but that will probably not be until Monday at the earliest.
 Originally Posted by Kurtilein
That is statistically impossible, because while gene transfer within a chromosome pair does happen, it is much more rare than simple recombination of chromosomes. Recombination of chromosomes happens every generation, gene exchange within a chromosome happens maybe once in 1000, or once in 10000. I dont dispute that it is a difference if two genes just sit on the same chromosome, OR if they sit on the same chromosome but also on the same location within that chromosome. Like for example albino, toffee, candy, it must be the same chromosome and the same location on the same chromosome. But if you can breed a super pastel super enchi without any problems, and you breed it to a normal and get 100% pastel enchis, that proves without any doubt that these two genes MUST be on different chromosomes. Or think about morphs with 4, 5 or more genes in them.
It is not statistically impossible, always remember Clarke's First Law: "When a distinguished but elderly scientist states that something is possible, he is almost certainly right. When he states that something is impossible, he is very probably wrong" 
I granted that it is totally unlikely but it is certainly possible.
Rough math here: Humane genome is ~25,000 genes on 23 chromosomes which works out to ~1000 genes per chromosome. Assume this as standard unit of measure (yes, an assumption but like I said, rough math here). So any one Ball python chromosome has ~1000 genes, for good measure we call half of them essential which leaves up ~500 genes that are possible to mutate and give a viable phenotype. There are how many base morphs?? Does not really matter because it is theoretically possible for all of them to be on a single chromosome when there are ~500 possible genes you can mutate.
And you can certainly have Enchi and Pastel on the same chromosome and get 100% Pastel Enchi from a SuperPastel SuperEnchi x normal breeding. The how and why will have to wait for my slide deck though.
 Originally Posted by Kurtilein
i think it means we have a chance to organize the morphs we know onto chromosomes without requiring genetic sequencing, using logic and statistics and breeding alone.
To a point yes, but again, this is going in to the realm of linkage. In a nutshell though, there comes a point where the greater the linkage distance between any two genes the harder it is to determine if they are on the same chromosome or different chromosomes.
 Originally Posted by Kurtilein
we know for a fact that these two gene complexes must reside on different chromosomes, because there are some morphs we can produce with good chances, like 12,5% or 25% or 6,25%, depending on the pairing. And to produce these if they would be on the same chromosome would be close to impossible, i mean, not in STRICTLY EVOLUTIONARY terms, but the odds would be like 0.01% because you need a crossover. the morphs: sulfur mystic mojave, sulfur super mojave, super mojave vanilla. Ok, not highly visible morphs, but still.
No, we do not know for a fact that BluEL and BlkEL are on different chromosomes for the reason I stated above. If they are on the same chromosome but have sufficient linkage distance then they will behave in a manner that is basically indistinguishable from two genes on separate chromosomes.
I will hunt down that slide deck and see if I can make things clearer next week
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|