Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 792

1 members and 791 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 25

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Quote Originally Posted by Kurtilein View Post
    albino is recessive, so, no, doesnt prove anything. a super fire het albino would prove something, an albino fire would prove something. Breedings of albino to fire het albino, or fire het albino to fire het albino, could prove or disprove it, but for now im just looking for the morph.
    Yeah, actually is does prove something. With a firm grasp of what recessive and incomplete-dominant mean we know that a recessive allele could not partially repress an incomplete-dominant allele at a given locus and so there would indeed be a visual phenotype if you were dealing with an allelic pair. And the fact that the Fire het Albino looks like nothing more than a Fire tells you that the WT allele at the Fire locus is partially repressing the Fire allele at said locus and theretofore, Albino and Fire cannot be allelic.


    And Mike, I disagree with you slightly on the SuperFire Albino. SuperFire would not fully mask the Albino presence; the eyes would be red.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    HypoLyf (03-29-2013),irishanaconda (03-29-2013),snakesRkewl (03-29-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1