Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 736

1 members and 735 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 25

Threaded View

  1. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire

    Quote Originally Posted by interloc View Post
    Clearly you don't know who aspilundii is( sorry cant spell). Basically he knows a redonk amount about genetics and if he says something is the way it is, there is a great chance that's what it is.
    Thank you for the props interloc . To be fair, I do not post on these boards that often and I do not expect everyone to know who I am. And while I may know a "redonk amount about genetics" there are still times I am wrong so I do not mind engaging in a good, well-spirited debate.

    Quote Originally Posted by interloc View Post
    Not everything is on WOBP. It's fun to mess around with but it isn't the final say in balls.
    This I think is the best message here. WoBP is not the end all be all. For me, it is a great place to look at pictures but I do not look for much else on it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    interloc (03-29-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1