» Site Navigation
1 members and 1,975 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,105
Threads: 249,255
Posts: 2,572,987
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Is there a way to tell het pied on appearance?
or maybe because the het pied phenotype is just as variable and very similar in appearance to a normal ball python, we have mistaken the gene for a recessive one but the gene is actually incompletely dominant.
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by asplundii
Granted not all caramels kink, but you never see a higher rate of kinking in the hets do you? The kinking condition is a result of a pathway disruption that is only there when both recessive alleles are present, in the presence of a WT allele there is no indication that the animal is a het unless you know that based on breeding.
Are you 100% on that? 
Again, you are talking homozygous vs. heterozygous condition. The specific condition is the result of a homozygous induced disruption. In the heterozygous condition there is no indication of any other factor associate.
Are you 100% on that too?
I do not deny that the above mentioned conditions are real but I do not think they are exactly in the same range of condition as the het pied marker. If pied is a recessive trait then the hets should be phenotype WT. If they are not phenotype WT then pied has to be a co-dom trait (albeit a state where the het form is a very very subtle one but we have that like with a few other morphs so it is not unheard of.)
Are you 100% on that one too?
Look at it in this manner:
When someone is breeding a pastel to a WT they usually pick a WT with high yellow/gold so as to enhance the pastel effect (why breed a pastel to a dark animal if it is just going to give you sub par pastels?) As a result, WT offspring from pastel breedings tend to be higher yellow animals.
And this?
No on is ignoring your speculation, however genetics in of themselves are complicated, and many are simply trying to wrap their heads around what co-dom vs incomplete dom really means.
Randy Remington is the guy people go to for guidance in understanding ball python genetics. Your broad declarations on the results from ball python breedings is really quite authoritative.
Have you been to a reptile show? Have you seen the multitudes of dirty brown pastels and normal looking co-dom morphs? I would think it's safe to say that few people are truly working on selective breeding, even far less likely are they accidentally selectively breeding for a trait that could be a marker.
I bring up deserts as my example number one. Look at the pattern changes the desert morph does to HET recessive animals like the desert het clown? Wow... it's really amazing.
Or perhaps there are genes at work in the marker animals that are expressed in the phenotype as "markers" when the heterozygous form of the recessive morph gene is present?
Maybe the way these genes work are not so cut and dry that we can say for CERTAIN that they only work this way, and there is NO possibility that the interactions, distance, or accumulation of genes has no phenotypical expression when the recessive gene of the desired morph is only heterozygous.
-
-
BPnet Veteran
Re: Is there a way to tell het pied on appearance?
markers arent 100% here's my example. Here's a pic of my 100% het pied:


Here's a female I bought as a normal/possible mystery het, looks like the same belly markings:
Ball pythons: 1.2 pastel, 1.0 Black Pastel 1.0 mojave(green) 0.1 spider, 1.0 het pied, 1.0 het clown, 1.1 het albino, 0.1 pos het albino, 1.0 shatter, 0.2 normals, 0.1 reduced pattern, 0.3 dinkers
Corn snakes: 1.0 blood, 0.1 het blood, 0.1 snow, 0.0.1 reverse okeetee
Geckos: 2.1.2 crested gecko, 0.0.1 leopard gecko
Boas: 1.0.1 sand boas
Other: 1.1 mini australian shepherd, 2.0 cats
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by littleindiangirl
Are you 100% on that?
Are you 100% on that too?
Are you 100% on that one too?
And this?
I am not 100% on anything and I have said that through out my postings. 
No on is ignoring your speculation,
Well I have not heard it spoken of anywhere so I do not think it is unreasonable to consider the possibility that it was not an idea tossed around. If no one is talking about it how am I to know that others are thinking about it? Hmmm??
however genetics in of themselves are complicated,
There is a reason for my signature I am not a neophyte to genetics. 
and many are simply trying to wrap their heads around what co-dom vs incomplete dom really means.
Yes, something that has not escaped my attention.
Randy Remington is the guy people go to for guidance in understanding ball python genetics.
That may be. I honestly would not know Randy from Joe on the street. From what I have read that Randy has posted I have enormous respect for him. (Cheers Randy ) However, just cause he is the "go to" guy does not make him the end all be all. "Authorities" and "experts" can still be wrong. And sometimes it is not that they are wrong it is just that there is something they may not have considered that an outside source might. In point of fact any real expert will happily admit that they do not know everything and will readily hear out other ideas.
Your broad declarations on the results from ball python breedings is really quite authoritative.
No more so than half the other broad declarations I have read on forums... Nothing authoritative about it. Point of fact I pretty much ripped that part about pastel breeding word for word from another thread here so... I was using it as an example, nothing more and nothing less.
That is moot however because I have said all along that I am:
1) Playing devil's advocate
2) Making generalizations
I am not claiming anything as 100% fact (as you seem to be accusing me of) but I am trying to get people to engage in an idea that I do not think is without merit. If nothing else just for some interesting conversation on an interesting topic.
Have you been to a reptile show? Have you seen the multitudes of dirty brown pastels and normal looking co-dom morphs?
Yes I have. That point does not prove anything.
I would think it's safe to say that few people are truly working on selective breeding, even far less likely are they accidentally selectively breeding for a trait that could be a marker.
That is a rather broad declarations you are making quite authoritatively. 
Personally, I am more inclined to think that serious breeder are being quite selective and that is obvious in the fact that they do not sell crap animals like $75 pastels and $300 lessers. Any closet breeder can slap two animals together for the intent of making a quick buck and co-coms are a great way to do that cause you get instant results. Investing a couple thousand in a pied is a little different (at least to me).
I bring up deserts as my example number one. Look at the pattern changes the desert morph does to HET recessive animals like the desert het clown? Wow... it's really amazing.
Yes it is amazing. But are you 100% certain that that is all down to the desert? What if that is something about the clown? Or maybe a hidden gene? Or maybe none of the above but a maternally inherited RNA factor (maybe the reciprocal will look different? Who can say?)
Or perhaps there are genes at work in the marker animals that are expressed in the phenotype as "markers" when the heterozygous form of the recessive morph gene is present?
Never denied that. As I have said all along I could be wrong. I am more than happy to admit that.
Maybe the way these genes work are not so cut and dry that we can say for CERTAIN that they only work this way, and there is NO possibility that the interactions, distance, or accumulation of genes has no phenotypical expression when the recessive gene of the desired morph is only heterozygous.
And once again, I never denied any of these things. I do find it ironic that you can sit here and lecture me about it not being so "cut and dry" when the whole point of my playing devil's advocate (as I have been saying I was doing all along) was done to get people to realize that maybe this whole marker thing is not as cut and dry as it is being made out to be...
Cheers
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
broadude (12-18-2008),Lexcorn (12-18-2008)
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by Brandon Osborne
Again I'll ask, why did the largest producer of Pieds in the world hold back all of this possible hets and sell the 100% hets? From what I know, the marker was first discovered by him.
Are you talking about Peter Kahl?
-adam
Click Below to Fight The National Python & Boa Ban


"The world is a dangerous place, not because of those who do evil, but because of those who look on and do nothing."
- Anna Sewell, author of Black Beauty
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by asplundii
And once again, I never denied any of these things. I do find it ironic that you can sit here and lecture me about it not being so "cut and dry" when the whole point of my playing devil's advocate (as I have been saying I was doing all along) was done to get people to realize that maybe this whole marker thing is not as cut and dry as it is being made out to be...
If your going to play devil's advocate, then don't take my responses to your advocacy so personally.
-
-
BPnet Veteran
Re: Is there a way to tell het pied on appearance?
Since it's a genetic trait - I sincerely doubt there is any physical features that would identify het anything.
1.1 Brazilian Rainbow Boas
1.0 Anerythrystic Brazilian Rainbow Boa
1.1 Het Albino Red Tail Boas
1.0 Albino motley Red Tail
1.2 Green tree pythons
1.1 Emerald Tree Boas
2.2 Corn snakes
1.3 Honduran Milks (1.1 alb, 0.1 het alb, 0.1 dbl het)
3.4 Ball pythons (Lemon bee, Spider & Pied males. 2 Pastels,poss het pied, girls)
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by DrLew
Since it's a genetic trait - I sincerely doubt there is any physical features that would identify het anything.
Do you really mean "genetic" trait or maybe "recessive" trait? I'd point out that pastel (co-dominant) is genetic and heterozygous pastels are identifiable. But even if you meant "recessive" I don't think pied is text book recessive but rather in a gray area with sporadic co-dominant tendencies. Maybe it's as simple as there being several different normal alleles of the piebald gene and the pied mutation can be either recessive or co-dominant depending on which "normal" allele it's paired with.
-
-
Re: Is there a way to tell het pied on appearance?
 Originally Posted by RandyRemington
I don't think pied is text book recessive but rather in a gray area with sporadic co-dominant tendencies. Maybe it's as simple as there being several different normal alleles of the piebald gene and the pied mutation can be either recessive or co-dominant depending on which "normal" allele it's paired with.
Now there is an interesting idea. Sort of like the "hidden" gene in the platty complex... Silent when paired with the true WT allele but causing the marker when paired with a pied allele... Very interesting...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: Is there a way to tell het pied on appearance?
Its also possilbe that whatever gene responsible for the het pied marker is a totally separate gene from the piebald gene. If the marker gene is positioned near enough to the piebald gene on the chromosome, it should be linked and inherited with the pied gene, which is why it tends to show up frequently in het pied animals. Like everyone is saying, this is definetlely not cut and dry, especially since there is no sequenced genom information on ball pythons and we really have no idea what genes are actually responsible for what mutation.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|