Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 784

1 members and 783 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,904
Threads: 249,099
Posts: 2,572,072
Top Poster: JLC (31,651)
Welcome to our newest member, GeneticArtist
Results 1 to 10 of 21

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are your thoughts on the more expensive morphs?

    Quote Originally Posted by Cee Jay View Post
    What is everybody's thoughts on the benefits of snakes that are in the $1000+ range ... Are they worth the money?
    Whether or not they are "worth the money" is entirely up to your own personal feelings. If it is worth it to you, then you buy the snake. If it is not worth it to you... Well, there you go, there is your answer.

    As an example: I I wanted a blackhead from about the time I was old enough to drive. When I finally decided to pull the trigger I went directly yo Derek Roddy and bought one from him. Just one animal, because I have no plans to breed the species. Blackheads are not "cheap" animals to begin with and Derek's animals are high quality so I will let you do your own math.

    Now, ask me if being able to walk down to my snake room on any given day and see one of my grail species was "worth" the money I paid. If you really need to hear my answer... Well, there you go, there is your answer.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (08-23-2019),Stewart_Reptiles (08-23-2019),Toad37 (08-23-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1