Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,811

0 members and 1,811 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,107
Threads: 249,255
Posts: 2,573,000
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Page 1 of 3 123 LastLast
Results 1 to 10 of 21
  1. #1
    Registered User Cee Jay's Avatar
    Join Date
    07-25-2019
    Posts
    65
    Thanks
    41
    Thanked 15 Times in 9 Posts

    What are your thoughts on the more expensive morphs?

    I have been looking to add another carpet once I get my second enclosure all squared away and searching places like Star Pythons and Nick Mutton's site, as well as morph market. What is everybody's thoughts on the benefits of snakes that are in the $1000+ range, or from the big-name breeders, vs. someone who is a lesser-known breeder selling for less? Are they worth the money?

  2. #2
    BPnet Veteran
    Join Date
    01-18-2018
    Posts
    649
    Thanks
    34
    Thanked 802 Times in 393 Posts

    Re: What are your thoughts on the more expensive morphs?

    Quote Originally Posted by Cee Jay View Post
    I have been looking to add another carpet once I get my second enclosure all squared away and searching places like Star Pythons and Nick Mutton's site, as well as morph market. What is everybody's thoughts on the benefits of snakes that are in the $1000+ range, or from the big-name breeders, vs. someone who is a lesser-known breeder selling for less? Are they worth the money?
    I don't know about the $1k snakes... Too expensive for myself as a pet keeper. For a breeder or someone who likes expensive, designer snakes, I can understand why they would not mind spending money up to the 5 digits or so for a snake. You get what you pay for. Sometimes it is due to its rarity, or the amount work and time it took for the seller to breed such snake so that work is reflected in the price.

    My husband recently surprised me with an albino paradox kenyan sand boa 100% het anery. She was from a reputable breeder who had been breeding for over 20+ years with lots of good reviews. The breeder was easy to talk to, knows when she last ate, what prey she ate and how (in a deli cup), has her birth date and pictures of her parents. The breeder made sure that I confirm with him delivery date with him or he won't ship. He also send a link with care information in case I need it. She is a beautiful little snake cost me about $250 + plus shipping.

    Then, I look at my banana morph ball python who I picked up at an expo almost 2 years ago. He was sold for $180 from a small time breeder with nothing about him online. The breeder did not know what they fed him, when he last ate, and maybe he had a shed. I should have known better at the time but I was a noob. Now that he is fully grown, I can see his coloring is more dull compared to a banana bred by other reputable breeders, like Dynasty, Nerd, etc...who asks for a much higher price. If I was a breeder, I would not breed my snake unless I plan on selling them for cheap.

  3. The Following User Says Thank You to Cheesenugget For This Useful Post:

    Cee Jay (08-22-2019)

  4. #3
    BPnet Veteran
    Join Date
    07-07-2019
    Posts
    537
    Thanks
    19
    Thanked 434 Times in 278 Posts
    Images: 9
    This years 4K snake is next years 1K an the next years $250 snake. "If" your trying to make a living, it's a business expense. Don't go into debt, save an wait. You have to feed it if you buy it, plus housing an med bills.

    How many of us have "rescued" snakes, dogs, houses an the like because the owner couldn't afford it?

    My two cents.

  5. The Following 3 Users Say Thank You to 303_enfield For This Useful Post:

    Bogertophis (08-23-2019),Cee Jay (08-22-2019),Lord Sorril (08-23-2019)

  6. #4
    Registered User Cee Jay's Avatar
    Join Date
    07-25-2019
    Posts
    65
    Thanks
    41
    Thanked 15 Times in 9 Posts

    Re: What are your thoughts on the more expensive morphs?

    I can see both sides. I think for the average person like myself who doesn't (plan) on having TOO many snakes in the future, it is somewhat of an investment in something nice - similar to a nice car. Cars we spend 30, 40, 50k+ on rarely last us 20+ years, but with good husbandry, a carpet python should last somewhere in that range. Not a bad investment if you are able to afford it I guess. At the same time, I am all for helping out or rescuing an animal in need. It kills me when people say they kill 4ft rattlesnakes like they are some monster. I totally understand their danger, but I think they can or should be moved respectfully to another area, even if it requires the assistance of an expert. My dream is to one day get into venomous snakes. I am amazed by their power and the fact that they have no idea how great it truly is in this small universe.

  7. The Following 2 Users Say Thank You to Cee Jay For This Useful Post:

    Awesomethepossum (08-22-2019),Bogertophis (08-23-2019)

  8. #5
    BPnet Veteran Awesomethepossum's Avatar
    Join Date
    07-09-2019
    Posts
    255
    Thanks
    275
    Thanked 435 Times in 161 Posts
    Images: 8

    Re: What are your thoughts on the more expensive morphs?

    Quote Originally Posted by Cee Jay View Post
    I can see both sides. I think for the average person like myself who doesn't (plan) on having TOO many snakes in the future, it is somewhat of an investment in something nice - similar to a nice car. Cars we spend 30, 40, 50k+ on rarely last us 20+ years, but with good husbandry, a carpet python should last somewhere in that range. Not a bad investment if you are able to afford it I guess. At the same time, I am all for helping out or rescuing an animal in need. It kills me when people say they kill 4ft rattlesnakes like they are some monster. I totally understand their danger, but I think they can or should be moved respectfully to another area, even if it requires the assistance of an expert. My dream is to one day get into venomous snakes. I am amazed by their power and the fact that they have no idea how great it truly is in this small universe.
    I hold the same sentiments.

    I only just purchased my first snake a couple of months ago, but coworkers and friends were shocked to find out how much I spent on him. All I can say is that he was cheaper than what it cost to adopt my dog.

    I value quality over quantity. I've seen old listings for his morph that were in the 3,500- 4,000 range. Today? Still expensive, but much cheaper. Same great snake. And he'll be around for quite a while.

    In regards to venomous snakes..it's been on my mind as well, but I think I'll stick with scorpions.

  9. The Following User Says Thank You to Awesomethepossum For This Useful Post:

    Bogertophis (08-23-2019)

  10. #6
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Images: 6
    Blog Entries
    1
    If your intention are two breed yes $1000 and up animals are something you will have to invest in if you want to remain competitive produce superior animals, make a return and add to an already flooded market when it comes to common morphs or in the case of carpets Mutts.

    If you want to make a return whether it's just to break even and have animals paying for themselves, have a little additional income or making a living, you will have to upgrade your collection every year and invest money, if you don't you will lose money each year, some people understand that and some don't (aka collection sale after 5 to 10 years)

    That's for the business part regardless of the species.

    Now for the pet part some people spend 1K+ for a dog or a cat, some spend 1K+ for a snake if that is something you truly like why not so long you can afford it.

    Now as far as carpet I am picky I like lineage and getting the best animals. I like the fact that I have some pure Albino Darwins and purity is often in question with many sellers that either don't know or do not want to tell, with Nick Mutton you won't have that issue.
    Last edited by Stewart_Reptiles; 08-23-2019 at 01:17 PM.
    Deborah Stewart


  11. The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    Cee Jay (08-23-2019),GoingPostal (08-23-2019)

  12. #7
    BPnet Royalty EL-Ziggy's Avatar
    Join Date
    11-05-2014
    Location
    GA
    Posts
    4,251
    Thanks
    5,140
    Thanked 5,582 Times in 2,731 Posts

    Re: What are your thoughts on the more expensive morphs?

    YOLO! Beauty is in the eye of the beholder so as long as it's worth it to you then it's money well spent. I've seen a few snakes I'd pay 1k for but I don't see me spending over $1500 for one. Eastern Indigos, Blackheaded Pythons, Albino Olive Pythons, and an IMG boa are a few special critters I'd drop that kinda coin for. I haven't seen a carpet I'd pay a G for yet. There's plenty of beautiful carpets I can get for less.
    Last edited by EL-Ziggy; 08-22-2019 at 11:51 PM.
    3.0 Carpet Pythons, 1.0 Olive Python
    1.0 Scrub Python, 1.1 BI

  13. The Following 6 Users Say Thank You to EL-Ziggy For This Useful Post:

    Bogertophis (08-23-2019),Cee Jay (08-23-2019),GoingPostal (08-23-2019),jmcrook (08-23-2019),Reinz (08-23-2019),Toad37 (08-23-2019)

  14. #8
    Registered User mechliam's Avatar
    Join Date
    05-28-2019
    Location
    Ireland
    Posts
    27
    Thanks
    2
    Thanked 19 Times in 15 Posts
    It all depends on what your intentions are for the snake. If it is a pet, and you have your heart set on a particular morph, then $1,000 may be a reasonable investment if you can afford it. Just remember that in 2-3 years the same snake will probably be worth at least half that. So, similar to buying a car, its up to the purchaser to decide if they want to spend the money to have the "latest model" knowing it will loose its value.

    If you are purchasing it with the intention of breeding, then it makes more sense to buy higher quality, more expensive snakes even though they may loose their value by the time they are ready to breed. Just hold off on buying the male.

    If you buy a female this year for $1,000 and a male next year for $700, that is a total value of $1,700. If the snakes value drops to $500 by the time you breed them, you will still make a hefty profit as long as you can find homes for them. If your female lays 8 viable eggs in her first season, you can make $4,000 from them. That is a profit of $2,300 (minus feeding, heating and housing costs etc). You are now in the green after one season of breeding. There are obviously risks associated with this such as the snake being unable to breed. Therefore you should only purchase a snake you can comfortably afford to keep, regardless of whether it breeds or not.

    Regarding purchasing off small or large breeders. I think this one is debatable. I think it is sometimes worthwhile buying from a breeder with a big reputation but I would't justify paying way over the value of the snake. A little more expensive is ok. This to me is mainly more important when buying hets. I would never buy a het from someone I don't know or trust. But every breeder has to start somewhere so I don't mind buying from smaller breeders as long as the snake is healthy and you can have a good conversation with the breeder etc.

    Liam.

  15. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are your thoughts on the more expensive morphs?

    Quote Originally Posted by Cee Jay View Post
    What is everybody's thoughts on the benefits of snakes that are in the $1000+ range ... Are they worth the money?
    Whether or not they are "worth the money" is entirely up to your own personal feelings. If it is worth it to you, then you buy the snake. If it is not worth it to you... Well, there you go, there is your answer.

    As an example: I I wanted a blackhead from about the time I was old enough to drive. When I finally decided to pull the trigger I went directly yo Derek Roddy and bought one from him. Just one animal, because I have no plans to breed the species. Blackheads are not "cheap" animals to begin with and Derek's animals are high quality so I will let you do your own math.

    Now, ask me if being able to walk down to my snake room on any given day and see one of my grail species was "worth" the money I paid. If you really need to hear my answer... Well, there you go, there is your answer.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  16. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Alicia (08-23-2019),Stewart_Reptiles (08-23-2019),Toad37 (08-23-2019)

  17. #10
    BPnet Veteran
    Join Date
    03-07-2019
    Posts
    810
    Thanks
    206
    Thanked 474 Times in 249 Posts
    My likes are very specific. I like lucys, albinos, high white pieds, and any other morph that doesn't have dark colors. I also like all black snakes. For me it is pretty much one extreme or the other. For example when I bought my boa. I always wanted an albino boa. I like what they look like, and I really enjoy the yellow that comes in later on in life. I could have spent over 1K for a lipstick line with some other recessive or co-dominant trait, but I decided a snake is a snake. I can always buy that more expensive snake later on down the line when they come down in price.

    Anyways lets get to the answer to the question I don't see a point in spending more than $500 on a pet. Now if its to breed then I can see myself spending 1k to 2k, otherwise I would just wait until what I want drops in price to sub $500.

    Now you ask if its worthit. I think it is. If you can get exactly what you want then it is worth it.

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1