Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 306

1 members and 305 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,060
Threads: 249,212
Posts: 2,572,741
Top Poster: JLC (31,651)
Welcome to our newest member, TillyMintz8613
Results 1 to 9 of 9

Threaded View

  1. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I will ante in as someone who has owned multiple egg eaters.

    Yes, you absolutely can co-hab them. Just make sure there are lots of hides so each of them can find a place to call their own and you also want to keep an eye on them just to make sure one is not hogging all the food. My only caution would be that they breed really easy so you should be ready for babies if you co-hab which means either having ready access to finch eggs or being prepared to syringe feed.

    As has been noted, you can pick up quail eggs from just about any international supermarket. One pack of 18 should be more than enough to get you through the year.


    Other things I will add here:

    -These animals are very fragile. I do not recommend handling them as it is all too easy to accidentally break/kink their spines
    -Give them vertical space. They are best treated as semi-/fully arboreal. They climb. A LOT. I have outfit my cage with numerous finch nests because those are the preferred hides
    -They need to be feed seasonally and sparingly. This should be a no-brainer - birds only breed during a very short period of the year so their food source is only available for a couple of months. If you are feeding weekly they will get obese
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    bcr229 (07-08-2019),Bogertophis (07-08-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1