Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,204

1 members and 1,203 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,143
Posts: 2,572,365
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 49

Thread: Making a BEL.

Threaded View

  1. #34
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by Aziara View Post
    As far as breeding for both healthwhise and most white, it looks like the consensus is to go with Mojave x Lesser..
    I am wondering though: would adding in pastel or super pastel increase the chances the snake stays pure white and never develops yellow or grey on it? Or would this have no effect?
    Not sure what Pastel would do. I am inclined to think it might put a light yellowish wash to the animal and increase the instance/prominence of the dorsal stripe.

    If I were aiming to push toward highest likelihood of pure white I would be more inclined to use Fire (or related allele) and possibly Yellowbelly. Champagne might also work but I can also see how it might backfire so...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (04-15-2019)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1