Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 723

1 members and 722 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 3 of 5 FirstFirst 12345 LastLast
Results 21 to 30 of 49

Thread: Making a BEL.

  1. #21
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Re: Making a BEL.

    Quote Originally Posted by Danger noodles View Post
    Look at JKR’s animals or even Debra’s on MorphMarket and u will see what the outcome of great quality animals.

    To to be completely honest, this isn’t a play around thing breeding animals. If u are this concerned about money and lack the basic knowledge of ball python genetics then u definitely shouldn’t be breeding them. If u are trying to learn then do some research for a few years and you will learn everything that has been said on this thread so true that u will feel silly for questioning it.
    Appreciate the help. Definitely not about the money. Just want to do it right.

  2. The Following User Says Thank You to ShawarmaPoutine For This Useful Post:

    Ronniex2 (11-19-2022)

  3. #22
    BPnet Veteran Danger noodles's Avatar
    Join Date
    10-15-2018
    Location
    Houston
    Posts
    740
    Thanks
    107
    Thanked 545 Times in 349 Posts

    Re: Making a BEL.

    Quote Originally Posted by ShawarmaPoutine View Post
    Appreciate the help. Definitely not about the money. Just want to do it right.
    It takes time to learn about these animals. There are more genes out there than any other snake! It’s crazy! But if ur passionate about it then u will enjoy the long route!

  4. #23
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Re: Making a BEL.

    Quote Originally Posted by Danger noodles View Post
    It takes time to learn about these animals. There are more genes out there than any other snake! It’s crazy! But if ur passionate about it then u will enjoy the long route!
    Which explains why I spent the past 12 hours researching and still know nothing.

  5. The Following User Says Thank You to ShawarmaPoutine For This Useful Post:

    Ronniex2 (11-20-2022)

  6. #24
    BPnet Veteran Danger noodles's Avatar
    Join Date
    10-15-2018
    Location
    Houston
    Posts
    740
    Thanks
    107
    Thanked 545 Times in 349 Posts

    Re: Making a BEL.

    Quote Originally Posted by ShawarmaPoutine View Post
    Which explains why I spent the past 12 hours researching and still know nothing.
    U know nothing Jon snow... lol

  7. The Following 3 Users Say Thank You to Danger noodles For This Useful Post:

    PartySnake13 (07-09-2019),ShawarmaPoutine (03-28-2019),Shayne (03-25-2019)

  8. #25
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by ShawarmaPoutine View Post
    I mean please help me understand how both of these are GHI + Mojave yet look so different:

    I mean I can understand that nothing comes out looking the same.. but what the heck is happening here? Is this because one of the parents was a good or bad example of either GHI or Mojave?
    The short answer is because in addition to the two genes you care about (GHI and Mojave) there are some 30,000-odd other genes that have can an effect on the final outcome of the animal. This is where the whole "selective" part of selective breeding comes in to play. If you like dorsal stripes than you buy animals that have strong dorsal stripes for your colony, even if it might mean they have less of the colouring you prefer. Likewise, if you like reduced patterning then you do not buy busy patterned animals.


    Now, as to how to get the whitest BluEL... I would agree with the Butter/Mojave option but I will caveat that all BluEL have the potential for a faint yellow dorsal stripe. If that bothers you then I would suggest trying to get Fire or Yellowbelly into it as well. Both of these have an impact on pigment deposition and so they can act in a synergistic manner.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Ronniex2 (11-20-2022),ShawarmaPoutine (03-25-2019)

  10. #26
    BPnet Veteran Alter-Echo's Avatar
    Join Date
    03-13-2018
    Location
    Albion NY
    Posts
    839
    Thanks
    621
    Thanked 780 Times in 453 Posts
    Adding hypo to a bel would probably work as well... when I breed my blackbee mojave orange ghost to my butter orange ghost, I'm hoping to test this.

  11. The Following User Says Thank You to Alter-Echo For This Useful Post:

    Ronniex2 (11-20-2022)

  12. #27
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by Alter-Echo View Post
    Adding hypo to a bel would probably work as well...
    I have a Hypo Lesser/Mojave, she has a dorsal stripe. It is faint but it is certainly there
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. The Following User Says Thank You to asplundii For This Useful Post:

    Alter-Echo (03-30-2019)

  14. #28
    Registered User
    Join Date
    03-28-2019
    Posts
    1
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Making a BEL.

    Does any combination of mojave and lesser make a BEL no matter if there are other genes in the snake? A breeder is selling a snake at the moment and is saying he believes there is mojave, lesser and fire in a snake which isn't white at all, it's an absolutely stunning looking snake, a full cream stripe on the back next to dark grey fading to cream the closer to the belly. I was just wondering if there are mojave lesser combos that aren't white?

  15. #29
    Registered User ShawarmaPoutine's Avatar
    Join Date
    07-05-2018
    Posts
    128
    Thanks
    77
    Thanked 60 Times in 39 Posts
    Images: 2

    Re: Making a BEL.

    Quote Originally Posted by Being_As_An_Ocean View Post
    Does any combination of mojave and lesser make a BEL no matter if there are other genes in the snake? A breeder is selling a snake at the moment and is saying he believes there is mojave, lesser and fire in a snake which isn't white at all, it's an absolutely stunning looking snake, a full cream stripe on the back next to dark grey fading to cream the closer to the belly. I was just wondering if there are mojave lesser combos that aren't white?
    A Butter x Mojave x Cinnamon isn’t white either. I am thinking that the presence of another gene added to the allelic pair (which made it a BEL) will make it look different from a BEL. But I’ll definitely wait for someone more experienced to chime in before I started preaching in the streets.

  16. #30
    BPnet Veteran Danger noodles's Avatar
    Join Date
    10-15-2018
    Location
    Houston
    Posts
    740
    Thanks
    107
    Thanked 545 Times in 349 Posts
    Yes some genes added in will change it. When ur reducing colors and add something like cinnamon that add back in color it changes everything. And no that’s probably not the right way to say that, so someone can chime in with the different pigmentations that each gene changes etc. but to answer the question is it just depends. if u want a bel just breed the right stuff and don’t take a chance.

Page 3 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1