Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 726

0 members and 726 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 49

Thread: Making a BEL.

Threaded View

  1. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Making a BEL.

    Quote Originally Posted by ShawarmaPoutine View Post
    Does a phantom x butter make a clean white snake?
    Butter/Phantom is a Karma. Sometimes they are white, sometimes they display a faint pattern. Check out RDR's breeding pages from 2015 or so, he has a great pic showing a full clutch of Karma that run the gambit


    Quote Originally Posted by ShawarmaPoutine View Post
    Has anybody proven whether or not Bug eyes are genetic and will be passed to offspring?
    It is genetic in as much as it is a secondary phenotype that occurs with increased appearance when breeding for SuperLesser. Just because the parent does not have it does not mean the offspring will not have it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Ronniex2 (11-20-2022)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1