Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 622

1 members and 621 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 28

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Same genes, different names...?

    Quote Originally Posted by JodanOrNoDan View Post
    subtle differences can often be remarked on, however there are always other genes at play that can change the appearance of the snake.
    And do not forget the effects of selective/line breeding (even if it is done subconsciously) which can also influence "differences"


    Quote Originally Posted by Avsha531 View Post
    Toffee/Candy?
    Toffee and Candy are absolutely the same. The original two animals were imported at the same time in the same bag and were siblings.


    Quote Originally Posted by Roux View Post
    I just bought 2 'paint' gene snakes. I believe that is the same as 'nazca'. And i think theres another out there that is similar.
    Neo (from RDR) and Sentinel (from Bill Stegal). Mark Haas had one too, cannot remember what it was called


    Quote Originally Posted by Roux View Post
    I have heard recently people calling fire and vanilla the same but i think theyre just allelic?
    Vanilla and Fire are allelic but definitely not the same, SuperVanilla are nothing like SuperFire.


    Quote Originally Posted by Roux View Post
    Many people suggest black pastel and cinnamon are the same, but i myself disagree on that one.
    I agree with you that BlkPastel and Cinny are different but there are others in the complex that are most likely the same, like HRA and GreenPastel and Lori

    I will also note that there are multiple lines of both BlkPastel and Cinny that have been imported.

    Quote Originally Posted by Roux View Post
    Hypo, ghost, and orange ghost are accepted by most to be the same gene, but the line varies the color vivacity.
    A caution here that there are some lines of Hypo that are not compatible. GCR-line Hypo has proven to be non-compatible and Graziani has two lines of Hypo (G1 and G2) that are also totally separate
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Sirus Uno (07-28-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1