» Site Navigation
0 members and 699 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
|
-
Registered User
Watching Brian Kuscos YouTube video on the Daytona show, there was a breeder there explaining how the puzzle gene came about from 2 pastels a customer bought off of him and bred. The resulting clutch contained pastel, super pastel, and some new looking animals now being the puzzle gene.
**LU BALLZ** (IG. @lu_ballz)
-
-
Well now I know why my eyes glaze over when y'all are talking about BP morphs. It's just crazy-confusing for those of us who don't "eat-sleep-& breathe"
BP's (& no offense to all of you that do). Sure hope you all get this sorted out & names agreed upon...
-
The Following 2 Users Say Thank You to Bogertophis For This Useful Post:
Dianne (09-15-2018),Sirus Uno (09-02-2018)
-
Registered User
Another example... Multiple "this is my line" fire gene... The "sauce".
**LU BALLZ** (IG. @lu_ballz)
-
The Following User Says Thank You to Sirus Uno For This Useful Post:
-
Registered User
Justin kobylka just confirmed in his new video... Confusion, acid, & static are 3 lines of the same gene!
**LU BALLZ** (IG. @lu_ballz)
-
The Following User Says Thank You to Sirus Uno For This Useful Post:
-
Re: Same genes, different names...?
 Originally Posted by Sirus Uno
Justin kobylka just confirmed in his new video... Confusion, acid, & static are 3 lines of the same gene!
Josh (founder of Acid) and myself have been saying this for over a year.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Same genes, different names...?
 Originally Posted by Sirus Uno
Another example... Multiple "this is my line" fire gene... The "sauce".

I read this snake name as pasta sauce!
-
-
Re: Same genes, different names...?
 Originally Posted by Ax01
dont forget...
Classic = Normal = Wild-type = Beautiful
You are so cool dude!
Sent from my iPhone using Tapatalk
-
-
Re: Same genes, different names...?
This is a great thread, quite informative for all ball python buyers and breeders.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to Godzilla78 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|