» Site Navigation
1 members and 1,048 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,144
Posts: 2,572,366
Top Poster: JLC (31,651)
|
-
Registered User
Same genes, different names...?
How many genes out there have multiple names?
I know there are a hell of a lot of different morphs and I know a bunch of them are just the same morph from a different line that do the same things when bred out to other morphs... ie;
Butter and lesser, calico and sugar, fire and inferno?, phantom and mystic, hypo and ghost...
Forgive me if this has been asked before... I tried looking.
**LU BALLZ** (IG. @lu_ballz)
-
-
Same genes, different names...?
 Originally Posted by Sirus Uno
How many genes out there have multiple names?
I know there are a hell of a lot of different morphs and I know a bunch of them are just the same morph from a different line that do the same things when bred out to other morphs... ie;
Butter and lesser, calico and sugar, fire and inferno?, phantom and mystic, hypo and ghost...
Forgive me if this has been asked before... I tried looking.
I don't think Butters are the same as Lessers are they ?? Although I guess they may carry the same genes/genetics ??
I'm no expert by any means .
In the uk we have a few names for Lessers ... they're also known as Platinums and Lesser Platinums ..
Sent from my iPhone using Tapatalk Pro
Last edited by Zincubus; 07-24-2018 at 07:24 AM.
-
-
I've heard varying thoughts on butter/lesser, but I've spoken to a couple breeders that believe it's the same thing. They're both in the BEL complex and both super lesser and lesser butter produce white snakes, so it certainly would seem they're the same. I can't exactly speak to how they react with other genes, though; I haven't looked that far yet. The biggest thing is that I think it's a difference of lines. They're essentially the same gene, just produced by different people.
Same with coral glow and banana.
Ball Pythons!
1.0 Normal - Echo
1.0 Spider Enchi Ghost - Whiskey
0.1 Super Pastel Lesser - Tango
1.0 Butter Spider Het Hypo - Foxtrot
Other Snakes!
0.1 Albino Paradox KSB - Socks
1.0 Jungle Carpet Python - JPEG
1.0 California Kingsnake - Salazar
Geckos!
0.2 Super Hypo Tangerine Leos - Riddle and Valkyrie
-
-
Re: Same genes, different names...?
 Originally Posted by Zincubus
In the uk we have a few names for Lessers ... they're also known as Platinums and Lesser Platinums ..
Platinum is the combo. It was what RDR called the original animal that he imported in. When he bred it out he got two phenotypes: ones that were basically WT looking (Daddy allele) and ones that looked like a less extreme version of the sire, hence "Lesser Platinum" which has been truncated down to simply "Lesser". When you breed a Lesser to a Daddy you get a Platinum (which RDR has also taken to calling PlattyDaddy)
 Originally Posted by Sirus Uno
How many genes out there have multiple names?
...
Forgive me if this has been asked before... I tried looking.
Try here, it should help you out: http://www.owalreptiles.com/complexes.php
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
JodanOrNoDan (07-24-2018),Sirus Uno (07-28-2018),Zincubus (07-24-2018)
-
Re: Same genes, different names...?
But just to clarify ..
Butters and Lessers are not the same 'looks-wise' ?
Yes ? No ?
Sent from my iPhone using Tapatalk Pro
-
-
Re: Same genes, different names...?
 Originally Posted by Zincubus
But just to clarify ..
Butters and Lessers are not the same 'looks-wise' ?
Yes ? No ?
This is a constant debate. Let me put it to you this way: If I went to a show and randomly bought 10 Butters and 10 Lessers and stuck them all in the same bag and sent you home with the bag, do you think you could sort them out perfectly as Butters and Lessers?
As far as I am concerned they are the same, the only difference is the manner they came in and who brought them in...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Craiga 01453 (07-24-2018),Godzilla78 (09-15-2018),Sirus Uno (07-28-2018)
-
also banana and coral glow
-
The Following 2 Users Say Thank You to AbsoluteApril For This Useful Post:
Godzilla78 (09-15-2018),Sirus Uno (07-28-2018)
-
I do not believe there is a difference between lesser and butter.
or mystic and phantom
or banana and coral glow
a couple of the variously named fire complex snakes seem to make the same stuff
all the pastels are the same
subtle differences can often be remarked on, however there are always other genes at play that can change the appearance of the snake.
I proved out a mojave this year that I didn't think was a mojave because she is so flipping dark, but she made purple passions and super mojaves so therefore in my head she is a mojave even if she doesn't look like my other mojaves.
Honest, I only need one more ...
-
The Following 4 Users Say Thank You to JodanOrNoDan For This Useful Post:
Godzilla78 (09-15-2018),Hannahshissyfix (08-30-2018),Sirus Uno (07-28-2018),the_rotten1 (07-25-2018)
-
Re: Same genes, different names...?
1.0 Kenyan Sand Boa - Sir Hiss🎩🐍
0.1 Pastel Ball Python - Exzahrah
0.1 Brazilian Rainbow Boa - Nymeria
0.1 Suriname Red Tail BCC- Sascha
0.1 WT Ball Python- Ariana
1.0 Bumblebee Ball Python- Fabio
WISHLIST:
Dumerils Boa
Candino BP
Granite IJ Carpet Python
White Lipped Python
Komodo Dragon
"Normal is just a setting on the washing machine..."
-
The Following 2 Users Say Thank You to Avsha531 For This Useful Post:
JodanOrNoDan (07-24-2018),Sirus Uno (07-28-2018)
-
dont forget...
Classic = Normal = Wild-type = Beautiful
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following 5 Users Say Thank You to Ax01 For This Useful Post:
Avsha531 (07-24-2018),Bogertophis (08-25-2018),Godzilla78 (09-15-2018),Sirus Uno (07-28-2018),stringbender31982 (07-24-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|