Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 729

0 members and 729 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,910
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 28

Threaded View

  1. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Same genes, different names...?

    Quote Originally Posted by Zincubus View Post
    But just to clarify ..

    Butters and Lessers are not the same 'looks-wise' ?

    Yes ? No ?
    This is a constant debate. Let me put it to you this way: If I went to a show and randomly bought 10 Butters and 10 Lessers and stuck them all in the same bag and sent you home with the bag, do you think you could sort them out perfectly as Butters and Lessers?

    As far as I am concerned they are the same, the only difference is the manner they came in and who brought them in...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Craiga 01453 (07-24-2018),Godzilla78 (09-15-2018),Sirus Uno (07-28-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1