Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,222

0 members and 1,222 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,142
Posts: 2,572,363
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 28

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Same genes, different names...?

    Quote Originally Posted by Zincubus View Post
    In the uk we have a few names for Lessers ... they're also known as Platinums and Lesser Platinums ..
    Platinum is the combo. It was what RDR called the original animal that he imported in. When he bred it out he got two phenotypes: ones that were basically WT looking (Daddy allele) and ones that looked like a less extreme version of the sire, hence "Lesser Platinum" which has been truncated down to simply "Lesser". When you breed a Lesser to a Daddy you get a Platinum (which RDR has also taken to calling PlattyDaddy)


    Quote Originally Posted by Sirus Uno View Post
    How many genes out there have multiple names?

    ...

    Forgive me if this has been asked before... I tried looking.
    Try here, it should help you out: http://www.owalreptiles.com/complexes.php
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    JodanOrNoDan (07-24-2018),Sirus Uno (07-28-2018),Zincubus (07-24-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1