Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 674

0 members and 674 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 20

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: How leopard affect other genes

    Quote Originally Posted by JodanOrNoDan View Post
    From what I heard from Nerd, a "Super" Leopard was produced by someone, don't recall the name, but what is actually a homozygous dominant. No visual change, just produces 100% Leopards.

    Has something changed?
    Graziani was the first to publicly comment on Leopard being a strict dominant type mutation with a homozygous that was not visually distinct from the heterozygous. He and I discussed it on ReptileRadio back in... I want to say early 2014.

    Kobylka has since put out a video wherein he said that he thinks there is a very subtle difference between the heterozygous and the homozygous, at least in some of the combos he has made. The trouble there is that all the animals he showed in the video were from Leo x Leo clutches and therefore only considered possibly homozygous and to the best of my knowledge neither he not anyone else has subsequently bred them out to confirm if his supposition was correct.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (07-23-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1