Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,867

1 members and 1,866 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,104
Threads: 249,252
Posts: 2,572,976
Top Poster: JLC (31,651)
Welcome to our newest member, GarlandFbj
Results 1 to 10 of 19

Threaded View

  1. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    This animal is most assuredly not a GStripe and I say that as someone working with GStripes.

    Your animal is the four gene combo. There is a wide range of expression in these animals, yours just happens to fall toward the extreme end. The dorsal striping is consistent with what you get in Mojave Pin combos. It also appear that you might have some form of Harlequin-type gene coming from the Mojave Pastel parent
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    Ax01 (04-11-2018),Godzilla78 (04-11-2018),rlditmars (04-11-2018)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1