Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,198

1 members and 1,197 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Page 1 of 2 12 LastLast
Results 1 to 10 of 12
  1. #1
    BPnet Veteran fLako0aGuiiLaR's Avatar
    Join Date
    09-15-2014
    Location
    Dallas Texas
    Posts
    373
    Thanks
    62
    Thanked 66 Times in 54 Posts
    Images: 7

    Cool Hottest genes in the market

    Which are the Hottest genes in the market right now?

    which are the genes that everyone wants to get? and also what project do you think is the best to invest in?

    thanks
    Last edited by fLako0aGuiiLaR; 10-20-2017 at 07:49 PM.
    -Chris

  2. #2
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    hottest genes that no can afford? Scaleless Head and Scaleless and Sunsets.

    hottest morphs/combos IMO are Highway/Freeway, multigene Clowns and OD Pied combos. hottest up and coming are Mahogany's, Bongo's, Spotnose, Het Red Axanthic/Red Axanthic and Axanthic recessive combos.

    the hottest consistent genes are Leopard, Banana/CG and any Pieds.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  3. #3
    BPnet Veteran Godzilla78's Avatar
    Join Date
    04-18-2016
    Location
    Asheville, NC, USA
    Posts
    2,382
    Thanks
    3,260
    Thanked 2,106 Times in 1,195 Posts
    Super Pastel Piebalds are the next big rage, just ask Chuck Norris.
    Last edited by Godzilla78; 10-20-2017 at 09:24 PM.

  4. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Hottest genes in the market

    Quote Originally Posted by Ax01 View Post
    hottest genes that no can afford? Scaleless Head
    IDK that I would call ScalelessHead unaffordable. Expensive, yes, but not "cost of a car" expensive.

    Cypress seems to be pretty hot right now. OD is always in demand. Sunset (as mentioned), Acid, and Rainbow are fairly high end and all look to have really strong potential
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #5
    BPnet Senior Member cchardwick's Avatar
    Join Date
    04-13-2016
    Location
    Bailey, Colorado
    Posts
    1,664
    Thanks
    15
    Thanked 1,050 Times in 622 Posts
    Images: 16
    I'd say Clowns and Pieds are the top two hottest that will always be in demand. Why? Because they blend well with other genes. Some people chase the newest genes like Rainbow, Acid and Sunset, mainly because they are newcomers to the market and pretty cool stand alone morphs, but I'm not too sure they will combine with other genes to make as many impressive combos as Clowns and Pieds (time will tell). I think the ability to blend to make a variety of beautiful impressive combos is what it's all about.

    The Highway / Freeway is a niche market, makes a lot of really cool combos, but unless you have supers it's hard to hit a whole clutch of them. Plus when you breed a Highway to a normal you can't tell the difference between the yellow belly and Gravel / Asphalt babies, they all pretty much look normal, another spin in the combo that turns people off (I think).

    Scaleless is probably the next big hit coming down the pipe. It basically reset the market and now you can do everything in scaleless, I would say that's another great investment with long term potential. You can pick up scaleless head normals now for about $1,000 and the price is coming down as we go, so not so out of reach of most people any more. You can breed them to your old normal females and get a pretty nice return from those normals!


  6. #6
    BPnet Veteran SDA's Avatar
    Join Date
    08-25-2017
    Location
    West Tennessee
    Posts
    1,559
    Thanks
    220
    Thanked 1,478 Times in 824 Posts
    Well there is the strong possibility that the hot genes you get that might need a few years to have those snakes mature to get to breeding age may cool down by the time you get them breeding. Super pastel (might not be something to qualify as genetic stock), cinnamon, acid, sunset, and of course scaleless head. Enchi, spider, pastel, and lesser are solid bases to create some killer morphs.

    Right now BEL are the "new hotness" but personally I think they are insanely over rated. Now give me a solid black morph and I will be super excited.
    1.0 ♂ 2010 Spider BP 'Dante'
    1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
    0.0.1 2017 Aru GTP 'Ganja'
    1.0 ♂ Blue Tick Coonhound 'Blue'

    1.0 ♂ 2018 Basset Hound 'Cooper'

  7. #7
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    you can't really go by price you have to look at future demand also. Scaleless has a far more limited market than most morphs. While rainbows command a high price, many think its over rated. Personally I think a solid top tier investment would be sunset. However that might be out of most peoples price range. I think super orange dream, cypress are pretty solid investments right now. Clown and pied combos are still in demand and show no sign of slowing down.

  8. #8
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: Hottest genes in the market

    Quote Originally Posted by OhhWatALoser View Post
    you can't really go by price you have to look at future demand also. Scaleless has a far more limited market than most morphs. While rainbows command a high price, many think its over rated. Personally I think a solid top tier investment would be sunset. However that might be out of most peoples price range. I think super orange dream, cypress are pretty solid investments right now. Clown and pied combos are still in demand and show no sign of slowing down.
    I agree with this except for one thing. Visual Sunsets are way expensive but a het male is not that bad. And while it will take longer working with hets investment wise a het male will pay for himself before you even produce a visual.


    Also. What about hurricane. Not many people are working with it in the USA I just got mine and she's going to my sunset project.
    Last edited by StillBP; 10-23-2017 at 02:04 PM.
    Laziness is nothing more than the habit of resting before you get tired.

  9. #9
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Hottest genes in the market

    Quote Originally Posted by StillBP View Post
    Also. What about hurricane. Not many people are working with it in the USA I just got mine and she's going to my sunset project.
    It has potential to be something, but havn't seen much game changing from it yet. I would call it a high risk until that game changing combo gets shown. I did forget about monsoon tho, thats another I would think is a solid investment.

  10. #10
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: Hottest genes in the market

    Quote Originally Posted by OhhWatALoser View Post
    It has potential to be something, but havn't seen much game changing from it yet. I would call it a high risk until that game changing combo gets shown. I did forget about monsoon tho, thats another I would think is a solid investment.
    Yes I also forgot about monsoon. But add it to the unaffordable list right now

    Sent from my XT1635-01 using Tapatalk
    Laziness is nothing more than the habit of resting before you get tired.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1