» Site Navigation
2 members and 1,776 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,105
Threads: 249,254
Posts: 2,572,984
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Hottest genes in the market
Which are the Hottest genes in the market right now?
which are the genes that everyone wants to get? and also what project do you think is the best to invest in?
thanks
Last edited by fLako0aGuiiLaR; 10-20-2017 at 07:49 PM.
-Chris
-
-
hottest genes that no can afford? Scaleless Head and Scaleless and Sunsets.
hottest morphs/combos IMO are Highway/Freeway, multigene Clowns and OD Pied combos. hottest up and coming are Mahogany's, Bongo's, Spotnose, Het Red Axanthic/Red Axanthic and Axanthic recessive combos.
the hottest consistent genes are Leopard, Banana/CG and any Pieds.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
Super Pastel Piebalds are the next big rage, just ask Chuck Norris.
Last edited by Godzilla78; 10-20-2017 at 09:24 PM.
-
-
Re: Hottest genes in the market
 Originally Posted by Ax01
hottest genes that no can afford? Scaleless Head
IDK that I would call ScalelessHead unaffordable. Expensive, yes, but not "cost of a car" expensive.
Cypress seems to be pretty hot right now. OD is always in demand. Sunset (as mentioned), Acid, and Rainbow are fairly high end and all look to have really strong potential
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I'd say Clowns and Pieds are the top two hottest that will always be in demand. Why? Because they blend well with other genes. Some people chase the newest genes like Rainbow, Acid and Sunset, mainly because they are newcomers to the market and pretty cool stand alone morphs, but I'm not too sure they will combine with other genes to make as many impressive combos as Clowns and Pieds (time will tell). I think the ability to blend to make a variety of beautiful impressive combos is what it's all about.
The Highway / Freeway is a niche market, makes a lot of really cool combos, but unless you have supers it's hard to hit a whole clutch of them. Plus when you breed a Highway to a normal you can't tell the difference between the yellow belly and Gravel / Asphalt babies, they all pretty much look normal, another spin in the combo that turns people off (I think).
Scaleless is probably the next big hit coming down the pipe. It basically reset the market and now you can do everything in scaleless, I would say that's another great investment with long term potential. You can pick up scaleless head normals now for about $1,000 and the price is coming down as we go, so not so out of reach of most people any more. You can breed them to your old normal females and get a pretty nice return from those normals!
-
-
Well there is the strong possibility that the hot genes you get that might need a few years to have those snakes mature to get to breeding age may cool down by the time you get them breeding. Super pastel (might not be something to qualify as genetic stock), cinnamon, acid, sunset, and of course scaleless head. Enchi, spider, pastel, and lesser are solid bases to create some killer morphs.
Right now BEL are the "new hotness" but personally I think they are insanely over rated. Now give me a solid black morph and I will be super excited.
1.0 ♂ 2010 Spider BP 'Dante'
1.0 ♂ 2017 Bay of LA Rosy Boa 'Queso'
0.0.1 2017 Aru GTP 'Ganja'
1.0 ♂ Blue Tick Coonhound 'Blue'
1.0 ♂ 2018 Basset Hound 'Cooper'
-
-
you can't really go by price you have to look at future demand also. Scaleless has a far more limited market than most morphs. While rainbows command a high price, many think its over rated. Personally I think a solid top tier investment would be sunset. However that might be out of most peoples price range. I think super orange dream, cypress are pretty solid investments right now. Clown and pied combos are still in demand and show no sign of slowing down.
-
-
Re: Hottest genes in the market
 Originally Posted by OhhWatALoser
you can't really go by price you have to look at future demand also. Scaleless has a far more limited market than most morphs. While rainbows command a high price, many think its over rated. Personally I think a solid top tier investment would be sunset. However that might be out of most peoples price range. I think super orange dream, cypress are pretty solid investments right now. Clown and pied combos are still in demand and show no sign of slowing down.
I agree with this except for one thing. Visual Sunsets are way expensive but a het male is not that bad. And while it will take longer working with hets investment wise a het male will pay for himself before you even produce a visual.
Also. What about hurricane. Not many people are working with it in the USA I just got mine and she's going to my sunset project.
Last edited by StillBP; 10-23-2017 at 02:04 PM.
Laziness is nothing more than the habit of resting before you get tired.
-
-
Re: Hottest genes in the market
 Originally Posted by StillBP
Also. What about hurricane. Not many people are working with it in the USA I just got mine and she's going to my sunset project.
It has potential to be something, but havn't seen much game changing from it yet. I would call it a high risk until that game changing combo gets shown. I did forget about monsoon tho, thats another I would think is a solid investment.
-
-
Re: Hottest genes in the market
 Originally Posted by OhhWatALoser
It has potential to be something, but havn't seen much game changing from it yet. I would call it a high risk until that game changing combo gets shown. I did forget about monsoon tho, thats another I would think is a solid investment.
Yes I also forgot about monsoon. But add it to the unaffordable list right now
Sent from my XT1635-01 using Tapatalk
Laziness is nothing more than the habit of resting before you get tired.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|