Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,340

1 members and 1,339 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,083
Threads: 249,223
Posts: 2,572,823
Top Poster: JLC (31,651)
Welcome to our newest member, Morphology
Page 2 of 2 FirstFirst 12
Results 11 to 17 of 17
  1. #11
    BPnet Veteran Aedryan Methyus's Avatar
    Join Date
    11-10-2016
    Location
    Pittsburgh, PA
    Posts
    933
    Thanks
    782
    Thanked 595 Times in 365 Posts
    Images: 7
    Thanks for all of your information you guys. Though, you are officially speaking beyond the scope of this nOOb's current knowledge... lol I doubt if I would ever breed an Albino Ball to a T- or T+ Blood, anyway. I was just curious... Just to be clear, though, is it possible that an Albino Ball could be compatible with a T- or T+ Blood or not?

  2. #12
    BPnet Veteran Trisnake's Avatar
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    551
    Thanks
    378
    Thanked 290 Times in 209 Posts
    Images: 1

    Re: Questions About Producing Super Ball Hybrids

    Quote Originally Posted by Aedryan Methyus View Post
    Thanks for all of your information you guys. Though, you are officially speaking beyond the scope of this nOOb's current knowledge... lol I doubt if I would ever breed an Albino Ball to a T- or T+ Blood, anyway. I was just curious... Just to be clear, though, is it possible that an Albino Ball could be compatible with a T- or T+ Blood or not?
    Its possible if the albinism allele is located at the same locus for both species. Sometimes it is (in the case of ball pythons and Burmese pythons) but I would say usually it is not, as it requires somewhat of a fluke of nature for two distantly related species of animal to develop analogous color mutations on the same loci as one another (unless that mutation had been present in a common ancestor hundreds of thousands of years ago and survived until modern times, which is arguably just as much a fluke of nature).

    Your best bet would be breeding an albino ball to a t-negative albino blood, as t+ and t- are rarely ever compatible within the SAME species much less two different species.
    Last edited by Trisnake; 08-12-2017 at 03:20 PM.

  3. The Following User Says Thank You to Trisnake For This Useful Post:

    Aedryan Methyus (08-14-2017)

  4. #13
    BPnet Veteran BPGator's Avatar
    Join Date
    06-25-2016
    Posts
    766
    Thanks
    330
    Thanked 462 Times in 274 Posts
    Images: 15

    Re: Questions About Producing Super Ball Hybrids

    Quote Originally Posted by AbsoluteApril View Post
    No.
    Fire is a co-dom trait so only the visual fires in the clutch would carry the fire gene. The 'morph' genetics will work the same as they do in BPxBP or any other species.
    Is this true? I've always considered recessive and dominant to be relative to the gene it's paired with. So in a Ball, the 'fire' gene is dominant to the 'normal' gene therefore it's visual. But in the Ball to Blood hybrid, is it not possible for the Blood's 'normal' gene to be dominant to the Ball's 'fire' gene thereby making the 'fire' gene recessive in the hybrid animal.


    Sent from my iPhone using Tapatalk

  5. The Following User Says Thank You to BPGator For This Useful Post:

    Aedryan Methyus (08-14-2017)

  6. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Questions About Producing Super Ball Hybrids

    Quote Originally Posted by paulh View Post
    The amelanistic mutant gene in corn snakes tests as T-negative albino with the dopa test, but it is actually a nonfunctional version of the OCA2 gene. (T-negative means the gene is a nonfunctional version of the gene that produces the tyrosinase enzyme. OCA2 stands for oculo-cutaneous albinism 2.) So there you have two "T-negative" mutant genes that have different locations in the cell nucleus.
    Small correction Paul; the T in T-neg is shorthand for tryrosinase which is the enzyme responsible for the very first step in the melanin biosynthesis pathway. A loss-of-function mutation to this gene causes the entire biosynthesis pathway to collapse as the process never gets started. The OCA2 gene (aka P gene), is actually a T-pos type mutant as tryrosinase is present in these mutants. The mutation is corn snakes was always just assumed to be T-neg but genetic evidence (I have not seen a DOPA-test in the literature but I have the genetic paper in my archives) showed this not to be the case. Further, OCA2 mutants still produce melanin but it is a defect within the melanocyte itself that prevents pigmentation.


    Quote Originally Posted by paulh View Post
    I am not aware of any boa or python albino mutations that have had the dopa test or any other biochemical tests run. When used with boas and pythons, T-negative albino generally means no visible black pigment (melanin). T-positive albino means some melanin but less than normal. That leaves a good bit of room for error.
    To the best of my knowledge the only genetic evidence we have for any snake "albino" is the corns. In everything else we just assume the classic yellow/white or red/white is a T-neg but, as the corns taught us, that assumption is potentially incorrect.


    Quote Originally Posted by BPGator View Post
    Is this true? I've always considered recessive and dominant to be relative to the gene it's paired with. So in a Ball, the 'fire' gene is dominant to the 'normal' gene therefore it's visual. But in the Ball to Blood hybrid, is it not possible for the Blood's 'normal' gene to be dominant to the Ball's 'fire' gene thereby making the 'fire' gene recessive in the hybrid animal.
    This is true. If you think about it, the WT gene (or an ortholog of it) will be in each species because they have a common ancestor that had the gene. This is exactly the reason you can get an Albino BurmBall, both species carry the same albino type gene. So the Fire allele in balls will have a WT, non-Fire allele in bloods and you will see the incomplete-dominant effect. How exactly that is expressed would have to be seen but the effect will not be radically different as witness the Spider ball x carpet, the Jag carpet x ball, and the SpinnerBlast ball x carpondro. All of those hybrids exhibited mutant phenotypes that behaved exactly along the lines you would expect.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Aedryan Methyus (08-14-2017),paulh (08-14-2017)

  8. #15
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Questions About Producing Super Ball Hybrids

    Quote Originally Posted by BPGator View Post
    Is this true? I've always considered recessive and dominant to be relative to the gene it's paired with. So in a Ball, the 'fire' gene is dominant to the 'normal' gene therefore it's visual. But in the Ball to Blood hybrid, is it not possible for the Blood's 'normal' gene to be dominant to the Ball's 'fire' gene thereby making the 'fire' gene recessive in the hybrid animal.


    Sent from my iPhone using Tapatalk
    It is possible for the ball python's fire gene to be recessive to the blood python's normal gene. But that is far less common than acting the same way as with the ball python normal gene. Experimental data is needed to be certain.

    Quote Originally Posted by asplundii View Post
    ....


    This is true. If you think about it, the WT gene (or an ortholog of it) will be in each species because they have a common ancestor that had the gene. This is exactly the reason you can get an Albino BurmBall, both species carry the same albino type gene. ....
    One of my genetics profs had an albino pigeon x ringneck dove hybrid (different genera). He was always careful to say that the albino mutants in the two species were alleles rather than identical. There are many ways to screw up a gene, and only DNA sequencing could show whether the two mutants were identical. The domestic pigeon genome either has been or is in the process of being sequenced. I don't think the dove genome has been sequenced yet.

    By the way, Aedryan Methyus, an Albino Ball could be compatible with either a T-negative or T-positive Blood. I am using the T-neg and T-pos terms in the loosest possible way. In corns, the amelanistic mutant gene (T-neg, no melanin) and the ultra mutant gene (T-pos, less than normal melanin) are compatible. In boa constrictors, the Sharp albino mutant gene (T-neg, no melanin) and the boawoman caramel mutant gene (T-pos, less than normal melanin) are compatible. So the equivalent of Sharp albino in one species and boawoman caramel in the other would be T-neg to T-pos compatibility. Sharp albino equivalent in both species would be T-neg to T-neg compatibility.
    Last edited by paulh; 08-14-2017 at 12:57 PM.

  9. The Following User Says Thank You to paulh For This Useful Post:

    Aedryan Methyus (08-14-2017)

  10. #16
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Questions About Producing Super Ball Hybrids

    Quote Originally Posted by paulh View Post
    One of my genetics profs had an albino pigeon x ringneck dove hybrid (different genera). He was always careful to say that the albino mutants in the two species were alleles rather than identical. There are many ways to screw up a gene, and only DNA sequencing could show whether the two mutants were identical. The domestic pigeon genome either has been or is in the process of being sequenced. I don't think the dove genome has been sequenced yet.
    No argument here, but my statement that the burm and the ball "carry the same albino type gene" was in reference to the WT form, not the mutant allele. Poor wording on my part.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. #17
    Banned
    Join Date
    01-27-2017
    Location
    MA, USA
    Posts
    10,560
    Thanks
    14,297
    Thanked 11,073 Times in 5,330 Posts
    Just wanted to say thanks to the OP and all who have contributed to this thread. It is waaaaaaayyyyyyy out of my realm of knowledge to this point and I found some of the info on her to be fascinating and educational.

    Not something I see myself working on personally in this lifetime, but the thought a carpet/BP hybrid is intriguing as a potential pet to add to the family someday.

    Please keep us posted with your work, studies, research, etc...

  12. The Following 2 Users Say Thank You to Craiga 01453 For This Useful Post:

    Aedryan Methyus (08-17-2017),asplundii (08-16-2017)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1