» Site Navigation
0 members and 1,021 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
|
-
Questions About Producing Super Ball Hybrids
I am very interested in producing some Super Balls at some point and I have a few questions that i'm hoping some of you guys could shed a little light on...
1) Does anyone know where I could find photos and/or videos of Sumatran x Ball hybrids and Borneo x Ball hybrids?
2) Would the pairing have to be a male Ball with a female Blood/Short Tail or could it be a male Blood/Short Tail with a female Ball?
3) Would both of the parent's genes be passed on to the offspring? For instance; If I crossed a Fire Ball Python with a Red Blood Python, would it make the offspring a brighter red?
Is the Super Ball shown at 1:13 in this video what all of the offspring would look like with a normal Red Blood x normal Ball or would some turn out red?
-
-
Re: Questions About Producing Super Ball Hybrids
1. I did a web search with the key words ball python blood python hybrids. There were a number of pictures among the hits.
2. I think either way would work as long as the male is not much bigger than the female. I have no direct experience, though.
3. Each baby gets one gene from each of the mother's gene pairs and one gene from each of the father's gene pairs. Hybrid babies tend to be more or less intermediate between the parents. IMO, half the babies from a fire ball python x normal red blood python would get the fire gene and be more red than the babies that did not get the fire gene. However, I greatly doubt that those fire babies would be as red as the blood python parent. That's the way it works with creamsicle corn snakes.
For what it's worth, I am not impressed by any of the hybrid pythons.
-
The Following User Says Thank You to paulh For This Useful Post:
-
Thanks, Paul. I can't find any photos or videos of Sumatran x Balls or Borneo x Balls, though. The only ones I can find are of Blood x Balls. If anyone happens to know of any, please be sure to let me know. In my opinion, I would think Sumatran x Balls would look the best of the three. I think the darkness, markings and girth of the Sumatrans combined with the colors, markings and length of Balls would look pretty sweet. On the other hand, it seems like a Ball crossed with a Blood or Borneo would simply produce brown snakes...
So, let's say I crossed a Sumatran with a Fire Ball... Would the non-visual offspring be Het for Fire and if so, what percentage?
Other than being careful to not put a huge male Blood/Short Tail with a female Ball that is much smaller, does anyone see any reason why that wouldn't be safe for the female?
-
-
I can't help you that much on the genetics of the thing. Hybridization is not something I have studied much. Maybe one of the genetics guys will jump in with something productive. What I do want to make you aware of is being careful about where you have this discussion. People on here are pretty mellow but there are some who have very strong negative opinions on the subject in general. I personally don't have a problem with it as long as the animals are coming out healthy and they are being sold as what they are.
Honest, I only need one more ...
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
Aedryan Methyus (08-10-2017),Craiga 01453 (08-15-2017)
-
Re: Questions About Producing Super Ball Hybrids
 Originally Posted by Aedryan Methyus
So, let's say I crossed a Sumatran with a Fire Ball... Would the non-visual offspring be Het for Fire and if so, what percentage?
No.
Fire is a co-dom trait so only the visual fires in the clutch would carry the fire gene. The 'morph' genetics will work the same as they do in BPxBP or any other species.
-
The Following 2 Users Say Thank You to AbsoluteApril For This Useful Post:
Aedryan Methyus (08-10-2017),Craiga 01453 (08-15-2017)
-
Re: Questions About Producing Super Ball Hybrids
 Originally Posted by JodanOrNoDan
I can't help you that much on the genetics of the thing. Hybridization is not something I have studied much. Maybe one of the genetics guys will jump in with something productive. What I do want to make you aware of is being careful about where you have this discussion. People on here are pretty mellow but there are some who have very strong negative opinions on the subject in general. I personally don't have a problem with it as long as the animals are coming out healthy and they are being sold as what they are.
I know this is a touchy subject for some people. I feel the same as you about it... Just so the offspring are healthy and fertile and they are sold exactly as what they are, I don't see the harm. My only concern would be if/when they exchanged hands in the future after the initial sale. I would hope that the future owners would be honest and responsible enough to make sure the buyers fully understood their genetics. At the same time, I feel like Bloods, Sumatrans and Borneos should be kept pure and not crossed with each other. I definitely look forward to making some Woma Balls in the not too distant future, too. Those are definitely awesome looking and I think they will open up a lot of very interesting possibilities for line breeding in the future!
 Originally Posted by AbsoluteApril
No.
Fire is a co-dom trait so only the visual fires in the clutch would carry the fire gene. The 'morph' genetics will work the same as they do in BPxBP or any other species.
Thanks, April! That makes sense... Here's an interesting thought... What if an albino Ball was crossed with an Albino Blood? Also, what if the Ball and Blood were both only Het Albino? Could they still produce Albino offspring?
-
The Following User Says Thank You to Aedryan Methyus For This Useful Post:
AbsoluteApril (08-10-2017)
-
Re: Questions About Producing Super Ball Hybrids
 Originally Posted by Aedryan Methyus
What if an albino Ball was crossed with an Albino Blood?
Bloods have T+ and T- versions of albino. Assuming neither is compatible with the albino gene in BP, breeding albino ball x albino blood would result in hybrids double het for both. Breeding those offspring would get you hybrid albinos expressing either of the albino genes or both at the same time. Would someone be able to tell the difference? I'm not sure.
It's kind of like the people that wanted to breed kahl strain and sharp strain albino boas to get DH and try to produce a snake expressing both strains, why? It most likely wouldn't look any different than a normal albino and all it would cause is mass confusion over which genes the animal actually carried.
 Originally Posted by Aedryan Methyus
Also, what if the Ball and Blood were both only Het Albino? Could they still produce Albino offspring?
Only if the albino genetics were the same in both species; both carried the compatible albino gene on the same locus. I assume they would not.
If you want to bring albino into the hybrid, my suggestion would be to pick one or the other, albino ball or one of the strain of albino blood, and use that to create your hets and then breed the hets for the visual.
Look at cremecicle corns, they are an albino hybrid of corn snake and emory rat snake, the albino gene comes from the corn snake. They are a pale orange color, the natural muted colors of the emory reduced the overall bright reds that were in the albino corn.
I hope this helps?
Last edited by AbsoluteApril; 08-10-2017 at 08:36 PM.
****
For the Horde!
-
The Following 4 Users Say Thank You to AbsoluteApril For This Useful Post:
Aedryan Methyus (08-10-2017),Craiga 01453 (08-15-2017),JodanOrNoDan (08-10-2017),paulh (08-11-2017)
-
Re: Questions About Producing Super Ball Hybrids
 Originally Posted by Aedryan Methyus
What if an albino Ball was crossed with an Albino Blood? Also, what if the Ball and Blood were both only Het Albino? Could they still produce Albino offspring?
 Originally Posted by AbsoluteApril
Bloods have T+ and T- versions of albino. Assuming neither is compatible with the albino gene in BP...
...Only if the albino genetics were the same in both species; both carried the compatible albino gene on the same locus. I assume they would not.
If I may... You make some assumptions April that are a little too overgeneralized. There is actually a decent likelihood of compatibility in Albino mutations as there are only a few genes that can be mutated to get the phenotype. So it is entirely possible to get an Albino hybrid in the F1 breeding. And very specifically, if you are breeding T-neg Albinos from both species together you are absolutely guaranteed to get Albino hybrids. This was done with BurmBalls, a het Albino burm was bred to a het Albino ball and generated a visual. I have also heard a rumour that someone has made an Albino Carpall from a visual x het cross.
The "grey" areas here would arise in situations where you have T-pos Albino types that are so extreme as to appear T-neg, like the Kahl and Sharpe boas you mentioned or the three different "white"-type Albinos in retics. If you were to breed one of these to a true T-neg you would not get a visual
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 5 Users Say Thank You to asplundii For This Useful Post:
AbsoluteApril (08-11-2017),Aedryan Methyus (08-11-2017),Craiga 01453 (08-15-2017),JodanOrNoDan (08-11-2017),paulh (08-11-2017)
-
Agreed, I was being very general in my speaking. I made the assumption even if both were tneg that there would be a great possibility it would not be on the same locus and therefor unlikely to create the visual. I was not aware that the albino genes in the burmese and ball were compatible, so thank you for the information!
-
The Following 2 Users Say Thank You to AbsoluteApril For This Useful Post:
Aedryan Methyus (08-11-2017),paulh (08-11-2017)
-
Re: Questions About Producing Super Ball Hybrids
 Originally Posted by AbsoluteApril
Agreed, I was being very general in my speaking. I made the assumption even if both were tneg that there would be a great possibility it would not be on the same locus and therefor unlikely to create the visual. ...
The amelanistic mutant gene in corn snakes tests as T-negative albino with the dopa test, but it is actually a nonfunctional version of the OCA2 gene. (T-negative means the gene is a nonfunctional version of the gene that produces the tyrosinase enzyme. OCA2 stands for oculo-cutaneous albinism 2.) So there you have two "T-negative" mutant genes that have different locations in the cell nucleus.
I am not aware of any boa or python albino mutations that have had the dopa test or any other biochemical tests run. When used with boas and pythons, T-negative albino generally means no visible black pigment (melanin). T-positive albino means some melanin but less than normal. That leaves a good bit of room for error.
-
The Following 3 Users Say Thank You to paulh For This Useful Post:
AbsoluteApril (08-11-2017),Aedryan Methyus (08-12-2017),Craiga 01453 (08-15-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|