» Site Navigation
2 members and 1,956 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,107
Threads: 249,255
Posts: 2,572,990
Top Poster: JLC (31,651)
|
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
 Originally Posted by JodanOrNoDan
For those of us that are big word challenged (like me), are you saying that it is more likely the both parents were het albino since there appears to be a lack of pattern consistent with a normal patterned animal?
LOL... Sorry, I lapsed into jargon there didn't I? Let me try again.
In a mosaic-type paradox, you have a situation where one of the alleles in the pair "drops out" so you see the effect on the allele that is left (this is called monoallelism). So, if we imagine a simple case of an animal that is WT het Albino, if the WT allele "drops out" all that is left is the Albino allele and the tissue patches in the "drop out" area will look Albino.
Now, if we posit that this animal here is a mosaic and not a chimera then genetically the animal would have to be a Yellowbelly het Albino and we would be seeing the Ivory phenotype from "drop out" of the WT allele at the YB locus and the Albino phenotype from "drop out" of the WT allele at the Albino locus. But you would not see these two separate and independent "drop out" events happening in an alternating pattern giving perfect, discreet regions of each. Instead, we would a more chaotic distribution of "drop outs" where some regions would be phenotypically YB, some areas would be AlbinoYB, some areas would be Ivory, and some areas would be Albino Ivory. We do not see the first and last of those phenotypes in this animal.
Flipside, if we posit that the animal here is a chimera then what you have is a case where there was a fusion event between an AlbinoYB zygote and an Ivory zygote which very easily gives rise to the two discreet and delineated phenotype regions that we are seeing.
Does that make more sense than my earlier gibberish?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
AbsoluteApril (07-26-2017),JodanOrNoDan (07-26-2017),Rcbeanxx (08-16-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|