Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 371

0 members and 371 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,083
Threads: 249,223
Posts: 2,572,821
Top Poster: JLC (31,651)
Welcome to our newest member, Morphology
Results 1 to 10 of 18

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Which male with Fire?

    Quote Originally Posted by JodanOrNoDan View Post
    I originally intended to breed her to a Enchi/Phantom/Pin but after looking at about a million pictures of the possible combos I am not having a lot of faith in my ability to detect the presence of the Fire gene in all the various possibilities.
    One problem I have come across when gauging by pictures is that they rarely have the "non-" form for comparison (e.g., Pastel next to FirePastel) so the differences can be harder to pick out. But when you have an actual clutch where the offspring with and without the gene in question then it is easier to pick out the different ones. I would also advocate you shoot for you original plan with the EnchiPhantomPin male. If you do end up having trouble IDing the babies I am sure there are a number of people who would be more than willing to help out.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (05-17-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1