» Site Navigation
0 members and 1,206 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
|
-
Which male with Fire?
Ok, so I bought an adult Fire female that I intended to breed next season but she is starting to get follicles so I am going to start to breed her now. I have never worked with Fire before. I originally intended to breed her to a Enchi/Phantom/Pin but after looking at about a million pictures of the possible combos I am not having a lot of faith in my ability to detect the presence of the Fire gene in all the various possibilities. Ideally, when dealing with a new (for me) gene like this I would prefer to have a super and know what I was getting but that is not the case.
For breeding purposes I would eventually want to produce a Super Fire male or make enough from the combos produced just to buy one outright.
The possibilities I have right now as far as males that I could put with this girl are....
Phantom/Pin
Enchi/Phantom/Pin
Spider Super Mojave
Mojave/Phantom/Pin
Lavender Albino Spider
Albino
Normal
For those that have worked with Fire, what would you do and why?
-
-
Any of the first four would be okay if you are not willing to purchase any more. If you like the "pied" look, get something with Disco in it!
Visit Bradbury Ball Pythons on Facebook and Instagram!
-
The Following User Says Thank You to artist&writer For This Useful Post:
JodanOrNoDan (05-17-2017)
-
Registered User
I would do the Enchi Phantom Pin, or the Super Mojave Spider this year. Next year I would try to find a Vanilla Pastel(maybe super vanilla so you would know everything would be a vanilla) to make Screams and creams
1.0 Banana Hypo
1.0 Pastave Enchi
1.0 Pastel +
0.1 Normal Het. Hypo
0.1 Killer Blast
0.1 Killer Calibee
0.1 Queenbee
-
The Following User Says Thank You to BigJay For This Useful Post:
JodanOrNoDan (05-17-2017)
-
Albino or Lavender Albino Spider b/c REL.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
The Following User Says Thank You to Ax01 For This Useful Post:
JodanOrNoDan (05-17-2017)
-
If you bought her to go to the enchi phantom pin I would recommend you go to him. But I second the comment on pastel vanilla next season
Laziness is nothing more than the habit of resting before you get tired.
-
The Following User Says Thank You to StillBP For This Useful Post:
JodanOrNoDan (05-17-2017)
-
Re: Which male with Fire?
 Originally Posted by JodanOrNoDan
I originally intended to breed her to a Enchi/Phantom/Pin but after looking at about a million pictures of the possible combos I am not having a lot of faith in my ability to detect the presence of the Fire gene in all the various possibilities.
One problem I have come across when gauging by pictures is that they rarely have the "non-" form for comparison (e.g., Pastel next to FirePastel) so the differences can be harder to pick out. But when you have an actual clutch where the offspring with and without the gene in question then it is easier to pick out the different ones. I would also advocate you shoot for you original plan with the EnchiPhantomPin male. If you do end up having trouble IDing the babies I am sure there are a number of people who would be more than willing to help out.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
JodanOrNoDan (05-17-2017)
-
Re: Which male with Fire?
 Originally Posted by artist&writer
Any of the first four would be okay if you are not willing to purchase any more. If you like the "pied" look, get something with Disco in it!
I like the Disco stuff even though I don't care for pied too much. It is tempting. I am going to a show Saturday. I am just working too many genes right now. I didn't even list out my yellowbelly complex stuff because I am not ready to start crossing complexes until I stabilize my Gravel project. On top of that, I will be male heavy once the babies from this season hatch due to males I need for my REL projects. There are only so many males I want to have to feed.
-
-
Re: Which male with Fire?
 Originally Posted by BigJay
I would do the Enchi Phantom Pin, or the Super Mojave Spider this year. Next year I would try to find a Vanilla Pastel(maybe super vanilla so you would know everything would be a vanilla) to make Screams and creams
Yeah I am really attempted to put the super mojave in. I have hatched quite a few mojaves and should not have any problem seeing the fire if it is there.
-
-
Re: Which male with Fire?
 Originally Posted by Ax01
Albino or Lavender Albino Spider b/c REL. 
Yeah, I am going there for the end game, but I need at least a super fire or I am going to end up with too many het lavender normals and spiders that will be hard to get rid of.
-
-
Re: Which male with Fire?
 Originally Posted by StillBP
If you bought her to go to the enchi phantom pin I would recommend you go to him. But I second the comment on pastel vanilla next season
 Originally Posted by asplundii
One problem I have come across when gauging by pictures is that they rarely have the "non-" form for comparison (e.g., Pastel next to FirePastel) so the differences can be harder to pick out. But when you have an actual clutch where the offspring with and without the gene in question then it is easier to pick out the different ones. I would also advocate you shoot for you original plan with the EnchiPhantomPin male. If you do end up having trouble IDing the babies I am sure there are a number of people who would be more than willing to help out.
As long as I can get help IDing babies it is probably back to the original plan. The Enchi/Phantom/Pin has been the perfect stud so far. He has three girls gravid. Was from a clutch last year. Color is holding well. Never stops eating. Good personality. Weighed him last night and he is already just shy of 1000 grams and 8 months old. His dad is a monster too. Bigger than a couple of my girls. Hopefully his babies are as good as his dad's. I still have two of his brothers that I am going to let go as soon as know he is producing what I want.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|