Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,401

0 members and 1,401 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 2 12 LastLast
Results 1 to 10 of 18
  1. #1
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Which male with Fire?

    Ok, so I bought an adult Fire female that I intended to breed next season but she is starting to get follicles so I am going to start to breed her now. I have never worked with Fire before. I originally intended to breed her to a Enchi/Phantom/Pin but after looking at about a million pictures of the possible combos I am not having a lot of faith in my ability to detect the presence of the Fire gene in all the various possibilities. Ideally, when dealing with a new (for me) gene like this I would prefer to have a super and know what I was getting but that is not the case.

    For breeding purposes I would eventually want to produce a Super Fire male or make enough from the combos produced just to buy one outright.

    The possibilities I have right now as far as males that I could put with this girl are....

    Phantom/Pin
    Enchi/Phantom/Pin
    Spider Super Mojave
    Mojave/Phantom/Pin
    Lavender Albino Spider
    Albino
    Normal

    For those that have worked with Fire, what would you do and why?

  2. #2
    BPnet Veteran artist&writer's Avatar
    Join Date
    05-20-2009
    Location
    Lexington, KY
    Posts
    520
    Thanks
    529
    Thanked 463 Times in 205 Posts
    Any of the first four would be okay if you are not willing to purchase any more. If you like the "pied" look, get something with Disco in it!
    Visit Bradbury Ball Pythons on Facebook and Instagram!

  3. The Following User Says Thank You to artist&writer For This Useful Post:

    JodanOrNoDan (05-17-2017)

  4. #3
    Registered User
    Join Date
    03-12-2015
    Posts
    136
    Thanks
    18
    Thanked 55 Times in 41 Posts
    Images: 1
    I would do the Enchi Phantom Pin, or the Super Mojave Spider this year. Next year I would try to find a Vanilla Pastel(maybe super vanilla so you would know everything would be a vanilla) to make Screams and creams
    1.0 Banana Hypo
    1.0 Pastave Enchi
    1.0 Pastel +
    0.1 Normal Het. Hypo
    0.1 Killer Blast
    0.1 Killer Calibee
    0.1 Queenbee

  5. The Following User Says Thank You to BigJay For This Useful Post:

    JodanOrNoDan (05-17-2017)

  6. #4
    BPnet Veteran Ax01's Avatar
    Join Date
    06-14-2015
    Location
    Emerald City
    Posts
    6,183
    Thanks
    2,581
    Thanked 6,152 Times in 3,380 Posts
    Albino or Lavender Albino Spider b/c REL.
    RIP Mamba
    ----------------

    Wicked ones now on IG & FB!6292

  7. The Following User Says Thank You to Ax01 For This Useful Post:

    JodanOrNoDan (05-17-2017)

  8. #5
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts
    If you bought her to go to the enchi phantom pin I would recommend you go to him. But I second the comment on pastel vanilla next season
    Laziness is nothing more than the habit of resting before you get tired.

  9. The Following User Says Thank You to StillBP For This Useful Post:

    JodanOrNoDan (05-17-2017)

  10. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Which male with Fire?

    Quote Originally Posted by JodanOrNoDan View Post
    I originally intended to breed her to a Enchi/Phantom/Pin but after looking at about a million pictures of the possible combos I am not having a lot of faith in my ability to detect the presence of the Fire gene in all the various possibilities.
    One problem I have come across when gauging by pictures is that they rarely have the "non-" form for comparison (e.g., Pastel next to FirePastel) so the differences can be harder to pick out. But when you have an actual clutch where the offspring with and without the gene in question then it is easier to pick out the different ones. I would also advocate you shoot for you original plan with the EnchiPhantomPin male. If you do end up having trouble IDing the babies I am sure there are a number of people who would be more than willing to help out.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  11. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (05-17-2017)

  12. #7
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by artist&writer View Post
    Any of the first four would be okay if you are not willing to purchase any more. If you like the "pied" look, get something with Disco in it!
    I like the Disco stuff even though I don't care for pied too much. It is tempting. I am going to a show Saturday. I am just working too many genes right now. I didn't even list out my yellowbelly complex stuff because I am not ready to start crossing complexes until I stabilize my Gravel project. On top of that, I will be male heavy once the babies from this season hatch due to males I need for my REL projects. There are only so many males I want to have to feed.

  13. #8
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by BigJay View Post
    I would do the Enchi Phantom Pin, or the Super Mojave Spider this year. Next year I would try to find a Vanilla Pastel(maybe super vanilla so you would know everything would be a vanilla) to make Screams and creams
    Yeah I am really attempted to put the super mojave in. I have hatched quite a few mojaves and should not have any problem seeing the fire if it is there.

  14. #9
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by Ax01 View Post
    Albino or Lavender Albino Spider b/c REL.
    Yeah, I am going there for the end game, but I need at least a super fire or I am going to end up with too many het lavender normals and spiders that will be hard to get rid of.

  15. #10
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77

    Re: Which male with Fire?

    Quote Originally Posted by StillBP View Post
    If you bought her to go to the enchi phantom pin I would recommend you go to him. But I second the comment on pastel vanilla next season
    Quote Originally Posted by asplundii View Post
    One problem I have come across when gauging by pictures is that they rarely have the "non-" form for comparison (e.g., Pastel next to FirePastel) so the differences can be harder to pick out. But when you have an actual clutch where the offspring with and without the gene in question then it is easier to pick out the different ones. I would also advocate you shoot for you original plan with the EnchiPhantomPin male. If you do end up having trouble IDing the babies I am sure there are a number of people who would be more than willing to help out.
    As long as I can get help IDing babies it is probably back to the original plan. The Enchi/Phantom/Pin has been the perfect stud so far. He has three girls gravid. Was from a clutch last year. Color is holding well. Never stops eating. Good personality. Weighed him last night and he is already just shy of 1000 grams and 8 months old. His dad is a monster too. Bigger than a couple of my girls. Hopefully his babies are as good as his dad's. I still have two of his brothers that I am going to let go as soon as know he is producing what I want.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1