» Site Navigation
0 members and 890 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,078
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
|
-
Re: Butters and Lessers, are there distinctions?
 Originally Posted by Lizardlicks
That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.
If that's the general consensus of the community, perhaps we should rebrand the morph as a single thing, like with pastels, then have separate lines to offer a distinction between them for those who have been maintaining a "pure" line.
As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.
Then you end up with 3 options, Plattys, Butter Plattys, and Lesser Plattys. Which leads to a group for undetermined snake lines, but maintains the line distinction, as with Pastels.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Registered User
Re: Butters and Lessers, are there distinctions?
So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?
-
The Following User Says Thank You to J880011 For This Useful Post:
-
Re: Butters and Lessers, are there distinctions?
 Originally Posted by Oxylepy
As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.
Except people (including RDR himself) generally use Platty as shorthand for PlattyDaddy so you would have to rewrite the entire usage of that epithet throughout the hobby which is as impossible as rebranding all of them to Lesser alone or Butter alone.
Also, rebranding the lines a la Pastel is not going to help in a case like Red's because, while there are different lines of Pastel, if you have a SuperPastel from two different lines once you breed it out I can just about guarantee you cannot ID which babies carry the allele from a specific line.
Really, it is easier to just let people call them whatever they want to call them. Both Butter and Lesser have been around long enough that neither is worth more than the other.
 Originally Posted by J880011
So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?
Yes, they do
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Butters and Lessers, are there distinctions?
 Originally Posted by asplundii
Also, rebranding the lines a la Pastel is not going to help in a case like Red's because, while there are different lines of Pastel, if you have a SuperPastel from two different lines once you breed it out I can just about guarantee you cannot ID which babies carry the allele from a specific line.
Alright, I'm kind of confused by this statement, I think we're on the same page with it, but something is being lost. What I was suggesting is a third generic term to incorporate offspring of exactly Red's situation. Leaving the two lines as distinct for those who would want them distinct, but as lines of the generic form. While the generic form would be for uncertain lineage.
If you breed 2 lines of Pastel together for a super, then that super pastel breeds and the offspring are unable to be identified as one line or the other, what you have as Pastels, the generic term.
Also, Platty is just me throwing that up against the wall, I even said the name would need to come from the community and was using that as an example (a personally liked one, but I'm not that attached to it)
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|