Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 591

1 members and 590 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,201
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 10 of 17

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Butters and Lessers, are there distinctions?

    Quote Originally Posted by Oxylepy View Post
    As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.
    Except people (including RDR himself) generally use Platty as shorthand for PlattyDaddy so you would have to rewrite the entire usage of that epithet throughout the hobby which is as impossible as rebranding all of them to Lesser alone or Butter alone.

    Also, rebranding the lines a la Pastel is not going to help in a case like Red's because, while there are different lines of Pastel, if you have a SuperPastel from two different lines once you breed it out I can just about guarantee you cannot ID which babies carry the allele from a specific line.

    Really, it is easier to just let people call them whatever they want to call them. Both Butter and Lesser have been around long enough that neither is worth more than the other.


    Quote Originally Posted by J880011 View Post
    So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?
    Yes, they do
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Oxylepy (04-21-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1