» Site Navigation
1 members and 721 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
|
-
Butters and Lessers, are there distinctions?
Alright, I am proposing this to the community as a whole, and trying to remove my own personal views from this.
Are there distinct differences between these two morphs?
If there are distinct differences that have held up over time seperating the lines, they must remain as they are, separate.
If there are not distinct differences between the two morphs that have held up over time they should be condensed into a single morph.
If there are distinct differences those differences need to be stated for identification purposes of the two lines, if those differences do not hold up to the vast majority of individuals within the line, they are not distint enough to be viewed as distinct differences.
Can we determine that there is a distinct difference between the lines for the purpose of line identification? Or can we not?
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
People like to think there is a difference, since "butters" are generally priced higher than lessers, but they're exactly the same. The only variation in pattern is the normal variation that occurs in any morph, and can be found in any lesser or butter animal.
I remember there was a thread someone on the forum made awhile ago that went like "Which ones are butters and which are lessers?" to prove if anyone can tell a distinct difference between the two, since some users were insisting that there was a difference. And he posted pictures of a few of his snakes. People were guessing and debating, which one looks more "buttery" than the others... In the end, the answer was that all of them were lessers, and he doesn't even own butters. LOL
Last edited by redshepherd; 04-18-2017 at 09:16 PM.
-
The Following 4 Users Say Thank You to redshepherd For This Useful Post:
Dezoruba (04-18-2017),Hannahshissyfix (04-20-2017),MushroomMang (08-14-2018),Oxylepy (04-18-2017)
-
Red that's great! I agree they're the same morph and have a few of each title that I wouldn't be able to differentiate if I hadn't labeled them as what they where purchased as.
-
The Following 2 Users Say Thank You to Hannahshissyfix For This Useful Post:
Matt850 (04-22-2017),Oxylepy (04-20-2017)
-
That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.
-
The Following User Says Thank You to Lizardlicks For This Useful Post:
-
Re: Butters and Lessers, are there distinctions?
 Originally Posted by Lizardlicks
That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.
Yeah, I also heard it's ethical to just keep going with differentiating the names. So I technically have to call my super lesser a "lesser butter", since that's what I bought him as LOL.
Last edited by redshepherd; 04-20-2017 at 09:46 PM.
-
The Following User Says Thank You to redshepherd For This Useful Post:
-
Haha, and see that's what I wonders, there are probably lot of lucies that came from a lesserxbutter pairing that then went on to make more babies. There's no way to tell what line they are, so what, do you just market it as the more expensive one?
-
The Following User Says Thank You to Lizardlicks For This Useful Post:
-
Red, considering you have a lesser butter, its offspring have now been muddied to the point you can no longer distinctly declare one a lesser and another a butter. Leading to an asterisk next to your animals, which can no longer clearly state a line distinction.
While you may engage in ethical behavior by disclosing this to customers, others may decide to not do so and sell one at a higher price because the name itself holds value in someone's eyes. The end result is further confusion.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Re: Butters and Lessers, are there distinctions?
 Originally Posted by Lizardlicks
That seems to be the general consensus I run into; they are the same morph, but the lines have been separate for so long that it's... idk considered good form or something? To continue labeling any snakes you produce according to what line you have.
If that's the general consensus of the community, perhaps we should rebrand the morph as a single thing, like with pastels, then have separate lines to offer a distinction between them for those who have been maintaining a "pure" line.
As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.
Then you end up with 3 options, Plattys, Butter Plattys, and Lesser Plattys. Which leads to a group for undetermined snake lines, but maintains the line distinction, as with Pastels.
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Registered User
Re: Butters and Lessers, are there distinctions?
So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?
-
The Following User Says Thank You to J880011 For This Useful Post:
-
Re: Butters and Lessers, are there distinctions?
 Originally Posted by Oxylepy
As an example, we rebrand them Plattys, so one can have a Butter line Platty, or a Lesser line Platty. Personally I like this name because it works well with Ralph's original Platinum (Platty Daddy), and the het daddy gene.
Except people (including RDR himself) generally use Platty as shorthand for PlattyDaddy so you would have to rewrite the entire usage of that epithet throughout the hobby which is as impossible as rebranding all of them to Lesser alone or Butter alone.
Also, rebranding the lines a la Pastel is not going to help in a case like Red's because, while there are different lines of Pastel, if you have a SuperPastel from two different lines once you breed it out I can just about guarantee you cannot ID which babies carry the allele from a specific line.
Really, it is easier to just let people call them whatever they want to call them. Both Butter and Lesser have been around long enough that neither is worth more than the other.
 Originally Posted by J880011
So I'm curious. Does a Butterxlesser bel run the same risks for bug eyes as a super lesser?
Yes, they do
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|