Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 831

0 members and 831 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 10 of 50

Threaded View

  1. #25
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by JodanOrNoDan View Post
    I think I may have thought that too in your situation if I had not already produced one without the enchi. I wish I had a better picture of this guy right now, but he is definitely PPP. There was no enchi involved in his breeding. The picture does not show the yellow dorsal very well, but it has gotten even more yellow as he has aged. Who knows? You may be right, but even the pattern seems right. It is so flipping hard to tell when the genes start adding up.
    Bugger!! My breeding was PhantomPin x Mochi so I was shooting from the hip on those three and it does look like I might have miscalled them... Guess someone got a sweet deal on the only PPEP to be sold LOL


    Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave


    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    tttaylorrr (04-04-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1