» Site Navigation
2 members and 4,571 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.
» Today's Birthdays
» Stats
Members: 75,881
Threads: 249,080
Posts: 2,572,018
Top Poster: JLC (31,651)
|
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by AbsoluteApril
be careful, I thought we aren't supposed to post photos from other sites, only list the link?
If that is the case I appreciate you saying this... I wasn't aware that was a rule
-
-
While I am cleaning up this thread to conform to our TOS here is a reminder
13. Respect bandwidth, copyrights, and ownership. Do not "hot-link" images from other websites or post copyrighted material without the express, written permission of the owner.
Please post links to the image you wish to share and that do not belong to you.
Thanks you
Last edited by Stewart_Reptiles; 04-04-2017 at 03:30 PM.
-
The Following 3 Users Say Thank You to Stewart_Reptiles For This Useful Post:
dr del (04-04-2017),Eric Alan (04-06-2017),kxr (04-04-2017)
-
Sorry deb!
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
The Following 2 Users Say Thank You to tttaylorrr For This Useful Post:
kxr (04-04-2017),Stewart_Reptiles (04-04-2017)
-
Re: Mojave/Pastel or other Mojave combos
I'll know for next time... Sorry for making you do so much extra work. I know I posted a lot of pictures 
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to kxr For This Useful Post:
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by kxr
Maybe stillbp disagrees or maybe they posted this simply because leopard Mojave hasn't been mentioned...
You're also comparing a two gene animal to a four gene animal. There are some awesome combos that have been made with Mojave leopard
I don't disagree. The highway mojo is super. However first correct the mojo leo was not mentioned. Second you can find a super nice mojo leo around $300 so your average hobbiest can afford it. The highway mojo is several thousand dollars and not likely to be bought by a average hobbiest.
Laziness is nothing more than the habit of resting before you get tired.
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by JodanOrNoDan
I think I may have thought that too in your situation if I had not already produced one without the enchi. I wish I had a better picture of this guy right now, but he is definitely PPP. There was no enchi involved in his breeding. The picture does not show the yellow dorsal very well, but it has gotten even more yellow as he has aged. Who knows? You may be right, but even the pattern seems right. It is so flipping hard to tell when the genes start adding up.
Bugger!! My breeding was PhantomPin x Mochi so I was shooting from the hip on those three and it does look like I might have miscalled them... Guess someone got a sweet deal on the only PPEP to be sold LOL
Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave

actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave

lovely babies!!!
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by tttaylorrr
lovely babies!!!
Thanks. I should get more current pics of them, they have developed nicely since I took those
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
Bugger!! My breeding was PhantomPin x Mochi so I was shooting from the hip on those three and it does look like I might have miscalled them... Guess someone got a sweet deal on the only PPEP to be sold LOL
Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave

I am absolutely amazed with how much better DG makes everything! Both those morphs without DG are average in my opinion but now with the DG they are breath taking! The brightness combined with contrast and darks that are actually dark, just awesome!
-
-
Re: Mojave/Pastel or other Mojave combos
 Originally Posted by asplundii
Thanks. I should get more current pics of them, they have developed nicely since I took those
 Originally Posted by rufretic
I am absolutely amazed with how much better DG makes everything! Both those morphs without DG are average in my opinion but now with the DG they are breath taking! The brightness combined with contrast and darks that are actually dark, just awesome!
seriously, those babies are stunners. asp, if you have any spares laying around feel free to let me know.
4.4 ball python
1.0 Albino ✮ 0.1 Coral Glow ✮ 0.1 Super Cinnamon paradox ✮ 1.0 Piebald ✮ 0.1 Pastel Enchi Leopard het Piebald ✮ 1.0 Coral Glow het Piebald ✮
1.0 corn snake
1.0 Hypo ✮
1.0 crested gecko
0.1 ???? ✮
0.1 cat
0.1 Maine Coon mix ✮
0.1 human ✌︎
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|