Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 698

2 members and 696 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,945
Threads: 249,139
Posts: 2,572,327
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 5 of 5 FirstFirst 12345
Results 41 to 50 of 50
  1. #41
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    740
    Thanks
    414
    Thanked 462 Times in 329 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by AbsoluteApril View Post
    be careful, I thought we aren't supposed to post photos from other sites, only list the link?
    If that is the case I appreciate you saying this... I wasn't aware that was a rule

  2. #42
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,812 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6
    While I am cleaning up this thread to conform to our TOS here is a reminder

    13. Respect bandwidth, copyrights, and ownership. Do not "hot-link" images from other websites or post copyrighted material without the express, written permission of the owner.
    Please post links to the image you wish to share and that do not belong to you.

    Thanks you
    Last edited by Stewart_Reptiles; 04-04-2017 at 03:30 PM.
    Deborah Stewart


  3. The Following 3 Users Say Thank You to Stewart_Reptiles For This Useful Post:

    dr del (04-04-2017),Eric Alan (04-06-2017),kxr (04-04-2017)

  4. #43
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22
    Sorry deb!
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  5. The Following 2 Users Say Thank You to tttaylorrr For This Useful Post:

    kxr (04-04-2017),Stewart_Reptiles (04-04-2017)

  6. #44
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    740
    Thanks
    414
    Thanked 462 Times in 329 Posts

    Re: Mojave/Pastel or other Mojave combos

    I'll know for next time... Sorry for making you do so much extra work. I know I posted a lot of pictures


    Sent from my iPhone using Tapatalk

  7. The Following User Says Thank You to kxr For This Useful Post:

    Stewart_Reptiles (04-04-2017)

  8. #45
    BPnet Senior Member StillBP's Avatar
    Join Date
    08-13-2015
    Location
    Pittsburgh PA
    Posts
    1,541
    Thanks
    464
    Thanked 1,034 Times in 657 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by kxr View Post
    Maybe stillbp disagrees or maybe they posted this simply because leopard Mojave hasn't been mentioned...

    You're also comparing a two gene animal to a four gene animal. There are some awesome combos that have been made with Mojave leopard
    I don't disagree. The highway mojo is super. However first correct the mojo leo was not mentioned. Second you can find a super nice mojo leo around $300 so your average hobbiest can afford it. The highway mojo is several thousand dollars and not likely to be bought by a average hobbiest.
    Laziness is nothing more than the habit of resting before you get tired.

  9. #46
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by JodanOrNoDan View Post
    I think I may have thought that too in your situation if I had not already produced one without the enchi. I wish I had a better picture of this guy right now, but he is definitely PPP. There was no enchi involved in his breeding. The picture does not show the yellow dorsal very well, but it has gotten even more yellow as he has aged. Who knows? You may be right, but even the pattern seems right. It is so flipping hard to tell when the genes start adding up.
    Bugger!! My breeding was PhantomPin x Mochi so I was shooting from the hip on those three and it does look like I might have miscalled them... Guess someone got a sweet deal on the only PPEP to be sold LOL


    Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave


    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    tttaylorrr (04-04-2017)

  11. #47
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by asplundii View Post
    Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave


    lovely babies!!!
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

  12. #48
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by tttaylorrr View Post
    lovely babies!!!
    Thanks. I should get more current pics of them, they have developed nicely since I took those
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  13. #49
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by asplundii View Post
    Bugger!! My breeding was PhantomPin x Mochi so I was shooting from the hip on those three and it does look like I might have miscalled them... Guess someone got a sweet deal on the only PPEP to be sold LOL


    Well I will add another couple for fun here, DesertGhost Mojave and DesertGhost Enchi Mojave


    I am absolutely amazed with how much better DG makes everything! Both those morphs without DG are average in my opinion but now with the DG they are breath taking! The brightness combined with contrast and darks that are actually dark, just awesome!

  14. #50
    BPnet Senior Member tttaylorrr's Avatar
    Join Date
    11-10-2014
    Location
    Chicago, Illinois USA
    Posts
    5,704
    Thanks
    4,501
    Thanked 5,435 Times in 2,891 Posts
    Images: 22

    Re: Mojave/Pastel or other Mojave combos

    Quote Originally Posted by asplundii View Post
    Thanks. I should get more current pics of them, they have developed nicely since I took those
    Quote Originally Posted by rufretic View Post
    I am absolutely amazed with how much better DG makes everything! Both those morphs without DG are average in my opinion but now with the DG they are breath taking! The brightness combined with contrast and darks that are actually dark, just awesome!
    seriously, those babies are stunners. asp, if you have any spares laying around feel free to let me know.
    4.4 ball python
    1.0 Albino 0.1 Coral Glow 0.1 Super Cinnamon paradox 1.0 Piebald 0.1 Pastel Enchi Leopard het Piebald 1.0 Coral Glow het Piebald

    1.0 corn snake
    1.0 Hypo

    1.0 crested gecko
    0.1 ????

    0.1 cat
    0.1 Maine Coon mix

    0.1 human ✌︎

Page 5 of 5 FirstFirst 12345

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1