» Site Navigation
2 members and 1,270 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,129
Posts: 2,572,283
Top Poster: JLC (31,651)
|
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
I did not go into any depth to the reply because it was not warranted. But since you want to again show your whit, allow me to clarify your own statements.
Thank you for the clarification. You are doing a better job of proving my larger argument that an Albino bat-eater is indeed possible in doing so.
I am well versed in the genetics of the Purple/White allele group of retics and I certainly did not need that lesson. It is nothing new for me and the same thing has been observed in many other species. But I do rescind that you do not understand the term locus, Purple and White are different alleles of the same locus and that is why the breedings in the Purple/White group turn out the way you describe.
You have enlightened me that I mistaken about there being a Green Albino retic. Fair enough, I said I was not fully up to par on the retic morphs in that regard.
And you say there is an Amel and a TypeIII and neither of these are compatible with the others
Knowing all of this, simply adds to my argument that an Albino bat-eater is absolutely possible.
In retics we have:
Amel
Purple/White group (Lav obviously being part of this since Lav is just a heteroallelic morph)
TypeII
TypeIII
And in Burms we have:
Albino
Purple
Green
With four different Albino loci in retic and three different loci in Burms there are twelve possible breeding combinations between the two species (I am going to skip typing them all out as I am sure you can figure them out.) If both species have a true T-neg type Albino (highly likely) then only one of those twelve combinations would yield an Albino bat-eater and the other eleven would give you double het animals. So I will ask you again, point blank: What Albino type of retic was used in your "proof" breeding? Amel, Purple/White, TypeII or TypeIII? And what Albino type of Burm was used in this same breeding? Albino, Purple or Green? And who, if anyone, has done the other eleven possible crosses?
If the "proof" breeding of Albino Burm to Albino retic was the wrong pair of loci between the species then you would not get an Albino bat-eater because they are incompatible loci. This is most likely what happened in the case you are citing. However, that does not change the fact that if you have the correct pair of loci (i.e., both T-neg in retic and T-neg in Burm) then you absolutely would get an Albino bat-eater.
So if, and only if, all twelve possible crosses have been made and in none of those cases an Albino bat-eater occurs then you can say that it is "impossible." But a single breeding that likely involved the wrong Albino types only proves that one or both of the parents was not a T-neg type Albino. It does not prove anything beyond that. It certainly does not prove that Albino bat-eaters are "impossible"
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|