» Site Navigation
0 members and 1,557 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,069
Threads: 249,219
Posts: 2,572,792
Top Poster: JLC (31,651)
|
-
Re: Two Headed Albino Bateater.
 Originally Posted by asplundii
I was not trying to say that the two-headed animal was absolutely a bat-eater, I do not have the knowledge to make that assessment and I gladly yield to others on that matter. All I was contending was that an Albino bat-eater could indeed occur.
What a wonderfully enlightened point of view, someone points out that you do not understand something and rather than consider that they might, just may be, correct you instead take the attitude that they are the stupid one...
You did misuse loci, your own words betray you:
Right there you say that all three types of Albino in retics fall on the same loci and then you say that they are all different/not compatible. If they all fall on the same locus then they would be compatible. Since they are not compatible they do not fall on the same locus.
There are (I believe) three separate and distinct Albino loci in retics:
Purple/White
Type II
Green
way to be wrong . . . When I say the three phases are compatible they are - Purple, white, and Lavander. You can breed a Lav x lav and you get all three phases, you can breed lax x purple and get lav and purple, lav x white and you get lav and whites, white x white all white, purple x purple all purple and purple x white = all lavs.
You can not breed Amel x Purple and get anything other than double hets, Amel being type II, and then a third type III that bob clark proved to again be distinct is not compatible with any of the rest. So recap there are 3 types of albino retics, of the type I there are 3 phases that are compatible with eachother showing different results. Each type is at a different Loci (or loucs) for each allele.
I did not go into any depth to the reply because it was not warranted. But since you want to again show your whit, allow me to clarify your own statements.
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
I did not go into any depth to the reply because it was not warranted. But since you want to again show your whit, allow me to clarify your own statements.
Thank you for the clarification. You are doing a better job of proving my larger argument that an Albino bat-eater is indeed possible in doing so.
I am well versed in the genetics of the Purple/White allele group of retics and I certainly did not need that lesson. It is nothing new for me and the same thing has been observed in many other species. But I do rescind that you do not understand the term locus, Purple and White are different alleles of the same locus and that is why the breedings in the Purple/White group turn out the way you describe.
You have enlightened me that I mistaken about there being a Green Albino retic. Fair enough, I said I was not fully up to par on the retic morphs in that regard.
And you say there is an Amel and a TypeIII and neither of these are compatible with the others
Knowing all of this, simply adds to my argument that an Albino bat-eater is absolutely possible.
In retics we have:
Amel
Purple/White group (Lav obviously being part of this since Lav is just a heteroallelic morph)
TypeII
TypeIII
And in Burms we have:
Albino
Purple
Green
With four different Albino loci in retic and three different loci in Burms there are twelve possible breeding combinations between the two species (I am going to skip typing them all out as I am sure you can figure them out.) If both species have a true T-neg type Albino (highly likely) then only one of those twelve combinations would yield an Albino bat-eater and the other eleven would give you double het animals. So I will ask you again, point blank: What Albino type of retic was used in your "proof" breeding? Amel, Purple/White, TypeII or TypeIII? And what Albino type of Burm was used in this same breeding? Albino, Purple or Green? And who, if anyone, has done the other eleven possible crosses?
If the "proof" breeding of Albino Burm to Albino retic was the wrong pair of loci between the species then you would not get an Albino bat-eater because they are incompatible loci. This is most likely what happened in the case you are citing. However, that does not change the fact that if you have the correct pair of loci (i.e., both T-neg in retic and T-neg in Burm) then you absolutely would get an Albino bat-eater.
So if, and only if, all twelve possible crosses have been made and in none of those cases an Albino bat-eater occurs then you can say that it is "impossible." But a single breeding that likely involved the wrong Albino types only proves that one or both of the parents was not a T-neg type Albino. It does not prove anything beyond that. It certainly does not prove that Albino bat-eaters are "impossible"
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
And If we find compatible genes than sure. But based on the crosses that have been done, based on the classification of these two species in general. And again you seem to find my misuing the term loci baffles me . . the allele is the part of the gene that controls the trait, the loci is the alleles location on that gene. This reflects what I've said again and again now. Read it carefully . . .
Why stop your assumptions there and lets start assuming that Blonde is compatible with bateaters! Why not? Blonde is a new "albino ish" type of phase. Since all its doing is coding for a reduction of certain pigments, as long as we can get something to match up its possible, but again we are talking VERY UNLIKELY. So allow me to state this again. These are White Phase Reticulated Pythons. No one has produced an Albino Bateater and they will not produce an albino bateater. This is based on our current understandings of these crosses. Not to mention the odds are against you. When you do a bateater cross you may see 32 eggs, and of those 7 may candle fertile. Of those 2 may survive to hatch date in some of the worst of cases.
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
Re: Two Headed Albino Bateater.
 Originally Posted by reptileexperts
And again you seem to find my misuing the term loci baffles me . . the allele is the part of the gene that controls the trait, the loci is the alleles location on that gene. This reflects what I've said again and again now. Read it carefully . . .
I read it very carefully. You, it seems, did not read my post carefully...
 Originally Posted by asplundii
But I do rescind that you do not understand the term locus
Rescind = to revoke, cancel, repeal, take back
I take back what I said about you not understanding the term loci.
(However that is not the correct definition of allele. Alleles are different forms of a gene. But now I am just being a smart-alack )
 Originally Posted by reptileexperts
But based on the crosses that have been done, based on the classification of these two species in general.
But you are citing only a single cross (that you still will not clarify the types involved) and saying that single cross proves an absolute. I disagree with that
 Originally Posted by reptileexperts
Why stop your assumptions there and lets start assuming that Blonde is compatible with bateaters! Why not? Blonde is a new "albino ish" type of phase. Since all its doing is coding for a reduction of certain pigments, as long as we can get something to match up its possible, but again we are talking VERY UNLIKELY.
I did not include Blonde because it is obviously not a T-neg type (neither are Purple/White in retics nor Green and Purple in Burms but that is getting a bit more deeply into it than I wanted to go) but there is nothing that prevents a Blonde-type bat-eater as well assuming that Burms carry a mutation of the same gene (something I do not know.)
 Originally Posted by reptileexperts
So allow me to state this again. These are White Phase Reticulated Pythons.
And again, I never contended the identity of this two-headed animal. All I was doing was saying that Albino bat-eaters are not impossible.
 Originally Posted by reptileexperts
And If we find compatible genes than sure.
The gene is certainly there, it is just the tyr gene and both species have the gene just like every other snake has the gene just like you and I have the gene.
 Originally Posted by reptileexperts
No one has produced an Albino Bateater and they will not produce an albino bateater. This is based on our current understandings of these crosses. Not to mention the odds are against you. When you do a bateater cross you may see 32 eggs, and of those 7 may candle fertile. Of those 2 may survive to hatch date in some of the worst of cases.
Just because no one has done it does not mean it cannot be done. I am assuming that by "current understanding of these crosses" you mean retic x Burm and not different types of Albinos. I will happily give you that the statistical odds are not that good. That said, genetically it is not just possible, it is an absolute. If you were to take a homozygous of whatever Albino type in retics that was T-neg and bred it to a homozygous of whatever Albino type in Burms that was T-neg then then the bat-eaters you got, however few, would be T-neg Albinos.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Two Headed Albino Bateater.
Beat this with a bat till its dead I suppose. . . But again,given the extremely unlikely possibility that you will get a matching mutation across these two species, I still stand in the unlikely hood that it may occur. Is it possible if all the stars line up? Sure. Just like the Burmese that proved to be capable of parthenogenesis. Can we then assume that all Burmese are capable. No... Can we assume that any are? No... A genetic odd ball does not give us enough evidence to suggest its capable of happening again the only point of this statement is to suggest just because something is possible based on the type of gene that is mutated it does not mean it is probable that it will likely occur.
Sent from my iPhone using Tapatalk
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
You and I will simply have to agree to disagree then.
It is not a matter of "probable" when dealing with an identical gene. If both parents lack the tyr gene then the resulting offspring will be Albinos. Does not matter if those parents are both retics, both Burms or if one parent is a retic and the other is a Burm.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
There are always those genetic misfits that make even the most realistic outcome fail to happen. I can aggree I suppose to the fact that if you proved out a variation of albino to be T- in both Burmese and Reticulated pythons, it should very well produce an albino bateater. But before we can get to that part, as people asked darwin "Where are the intermediates???"
-------------------------------------------------------
Retics are my passion. Just ask.
www.wildimaging.net www.facebook.com/wildimaging
"...That which we do not understand, we fear. That which we fear, we destroy. Thus eliminating the fear" ~Explains every killed snake"
-
-
That's definitely the two-headed retic from Prehistoric.
1.1 Ball Pythons
a) Calliope 0.1, Banana Ball, 2018/19 season, 600g
b) Geralt 1.0 Chocolate Sable Mojave pos. Trick ball, May 27th 2020
3.2 Cats (Fury, Leviathan, Walter, Chell, Amelie); 2.0 Dogs (Bjorn, Anubis); 2.1 Ferrets (Bran, Tormund, Arya); 0.1 Beardie (Nefertiti); 0.1 Slider Turtle (Species uncertain) (Papaya); 2.0 Hermit Crabs (Tamatoa, Sushi); 0.1 Conure (Mauii); Two Axolotyls (Quetzl and Unnamed); Two Tree Frogs (Pluto and Colossus); One Anole (Zeus); One Crestie (Noferatu); 3.0 Guinea Pigs (Paco, Poncho and Piccolo); 0.1 Pink Toe T (Azula)
Fish:
1.1 Oscar Cichlids (Rocky 1.0, hx2020, Red Fire, and Bubble 0.1, hx2019, Tiger), 1.1 Convict Cichlids (Hurley and Sloane), 0.1 Strawberry Peacock Cichlid (Comet), Two Plecos, Rubby the Rubbernose Pleco and Trinidad the common Pleco, 2.0 Upside Down Catfish (Poseidon, Neptune), One Red Parrot Cichlid (Firefly), 1.0 Betta Fish (Jenkins), 2.2 Cherry Barbs ("The Worst"), 1.0 Electric Blue Acara (Goldeneye)
-
-
Registered User
Re: Two Headed Albino Bateater.
About 12 years ago I had a group of albino Burmese x retics. They were produced from breeding an albino Burmese python to a retic, then raising the 50/50 hybrid babies that were het albino and breeding them back to mom, the albino burm. so the ensuing babies were 75% Burmese, 25% retic and were both normal colored and visual albinos and were very odd looking snakes that were not as radical looking as the 50/50's I had but they were very obviously not albino burms. I purchased them from a breeder in England and sold them all in the United States over the next few years. E
-
-
BPnet Veteran
Re: Two Headed Albino Bateater.
 Originally Posted by asplundii
You are misusing the term "loci" in all of this and that is the first issue here.
The three phases of Albino retic are 1) the Purple/White allele group 2) Green and 3) TypeII. Each of these phases is a mutant gene at a given locus. The Purple/White locus is completely unrelated to the Green is completely unrelated to the TypeII. If I breed a TypeII to a Purple I do not get an Albino I get double hets. These are totally different genes
And in Burms you have 1) Albino 2) Purple Albino and 3) Green Albino. And just like above, the Albino locus is completely unrelated to the Purple is completely unrelated to the Green. And again, just like above if I breed a Green to a Purple I do not get an Albino I get double hets. These are totally different genes.
Now, if I breed a Green Burm to a TypeII retic what do I get?? I do not know and neither do you because neither of us know if the Green gene in Burms is the same gene as the TypeII gene in retics. But, given what I do know about the genetics of Albinos in many animal species I feel it is pretty safe to say that these genes are different and so what we would get is double het bat-eaters
And if I breed a typical Albino Burm to a White retic what do I get?? Again I do not know and neither do you because neither of us know if the Albino gene in Burms is the same gene as the White gene in retics. This one is a bit trickier because a Albino Burm and a White retic both appear to be T-neg types. But, again, given what I do know about the genetics of Albinos in many animal species I again feel comfortable saying that these genes, while phenotypically similar, are actually different and so what we would get is once again double het bat-eaters.
Last one, if I breed a typical Albino Burm to a TypeII retic what do I get?? Again I do not know and neither do you because neither of us know if the Albino gene in Burms is the same gene as the TypeII gene in retics. And again, this one is tricky because a Albino Burm and a TypeII retic both appear to be T-neg types. But if they are both T-neg types then, instead of getting double het bat-eaters what you get is T-neg type Albino bat-eaters.
So, once again, the important factor here is to know what types of Albino were used in the breeding you are citing versus they types of Albino used to create this two-headed animal. Because if you are talking about a Green Burm to a TypeII retic but this guy bred a Albino Burm to a TypeII retic then your citation is the apple and this guys breeding is the orange
Could you explain more about the bolded items, just curious. I have never heard of these phases of albino or never heard of them referrd by that name. thanks in advance.
Last edited by Aztec4mia; 10-16-2013 at 06:29 AM.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|