» Site Navigation
2 members and 1,560 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,808
Top Poster: JLC (31,651)
|
-
Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by Kurtilein
allelic or not, what if two morphs just sit on the same chromosome pair? But otherwise they dont affect each other, nothing really visible, its just that you hit a wall when you try to combine them, because you can only have two of these genes maximum. One gene per chromosome, chromosomes are in the same pair, so a snake can only have two of these, one from mom one from dad... you get the idea. If two true recessives would have that issue, and you try to combine them, the first thing you notice is that when breeding double hets to double hets, the odd gods just seem to hate you very very much and you just fail to hit the double recessive visual.
the complete genome of the ball python only has 18 chromosomes. and how many base morphs do we have?
we know 6 gene complexes so far. i just for fun tried to find morphs that prove that all these complexes are, in fact, seperate. Basically going at the problem backwards: no assumptions, i just see how far i can go simply by proving that two genes are NOT on the same chromosome and fully compatible.
a sample of my findings so far, just for the known gene complexes, and yes i use my own abbreviations and terms:
Code:
known 6 complexes set:
BEL, albino, pied, Cin/BlkPa/RedAx, Ivory/Superstripe, Disco/F/Sulfur/V
BEL albino: albino lesser, albino mojave, albino super mojave , ? <<<<done
BEL pied: lesser pied, enchi lesser pied, mystic pied, mojave pied <<<<<done
BEL Cin/BlkPa/RedAx: super cin mojave, lesser super cin, lesser red ax, red ax mystic <<<<<done
BEL Ivory/Superstripe: ivory mojo phantom, butter superstripe, phantom SS, mojo SS, ...<<<<<done
BEL Disco/F/Sulfur/V: sulfur mystic mojave, sulfur super mojave, super mojave vanilla <<<<done
albino pied: clear visible albino pied <<<<<done
albino Cin/BlkPa/RedAx: albino super cinny, albino super black pastel <<<<<done
albino Ivory/Superstripe: albino (+pastel) yellow belly, albino ivory <<not much
albino Disco/F/Sulfur/V: !!!!!!! !!!completely missing!!!
pied Cin/BlkPa/RedAx: super cinnamon pied, lots of cinnamon pied, super blkpa pied. <<<<<done
pied Ivory/Superstripe: pumpkin pied, ivory pied, <<not much
pied Disco/F/Sulfur/V: fire pied < just 1 morph
Cin/BlkPa/RedAx Ivory/Superstripe: cinnamon superstripe, black pastel superstripe <<not much
Cin/BlkPa/RedAx Disco/F/Sulfur/V: mercury ball (fire supercinny), ..? < just 1 morph
Ivory/Superstripe Disco/F/Sulfur/V: fire ivory, ivory vanilla, fire pastel superstripe,
lots of vanilla superstripe <<<<<done
so, im almost done proving that the 6 known BP gene complexes do sit on different chromosome pairs by compiling morphs that contain 3 or 4 copies of just the right genes. i have already proven that the 6 known gene complexes sit on at least 5 different chromosomes. (ive also already proven that clown does not sit on any of the chromosomes inhabited by the 6 known gene complexes, i found all morphs required to do so. with enchi i ran into an issue.)
you know that feeling when you are 90% done with something, and then hit a wall. about visible or not.... just an albino fire, should be visible, at least if you have a clutch containing albino and albino fire. i mean, someone bred an albino pied blue eye lucy and proved it out, people go to crazy lengths for a world first, or so you would think. low-hanging fruit for a world first morph i think.
or, the enchi issue.... enchi red axanthic, super enchi cinnamon, super enchi het red axanthic, super enchi black pastel, enchi cinnamon het red axanthic, enchi black pastel het red axanthic. <----- From what we know, only super cinnamon, super black pastel, and cinnamon black pastel destroy the pattern and lead to patternless snakes. All the other enchi combos i listed could, as far as we know, have a pattern, at least they dont contain something that would definitively ruin the pattern. All of these would be world firsts that noone seems to have done yet, all are either a super + one more gene, or a 3-gene combo.
Clearly you don't know who aspilundii is( sorry cant spell). Basically he knows a redonk amount about genetics and if he says something is the way it is, there is a great chance that's what it is.
Also. Ever think that maybe others know more about genetics than you and they haven't made those combos because they wouldn't be that cool? Or maybe they were made and not posted? Or maybe they were not made and are some people's projects? Not everything is on WOBP. It's fun to mess around with but it isn't the final say in balls.
-
The Following 6 Users Say Thank You to interloc For This Useful Post:
asplundii (03-29-2013),C&H Exotic Morphs (03-29-2013),Domepiece (04-09-2013),HypoLyf (03-29-2013),irishanaconda (03-29-2013),Mike41793 (03-29-2013)
-
Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by interloc
Clearly you don't know who aspilundii is( sorry cant spell). Basically he knows a redonk amount about genetics and if he says something is the way it is, there is a great chance that's what it is.
Also. Ever think that maybe others know more about genetics than you and they haven't made those combos because they wouldn't be that cool? Or maybe they were made and not posted? Or maybe they were not made and are some people's projects? Not everything is on WOBP. It's fun to mess around with but it isn't the final say in balls.
All of this^.
-
The Following User Says Thank You to Mike41793 For This Useful Post:
-
Kurt, you are confusing your terminology which in turn is confusing you.
Gene complexes have nothing to do with the number of chromosomes. Theoretically it is entirely possible for the mutations that gives rise to every known morph to all be located on a single chromosome (and, no, I do not honestly believe that is the case but that does not change the fact that it is possible.) You point out that there are 18 chromosome pairs in ball pythons as if that means something about the number of morph alleles that are possible and how they have to group. The number of chromosomes means very little when it comes to the number of genes in the animal total and how they are grouped. The genes for BluEL and BlkEL could be on the same chromosome or different chromosomes and you would never know without a molecular level investigation.
Gene complexes are just groups of genes that are all alleles of one another. All alleles have to sit at the same locus on the chromosome but beyond that there is no real affiliation with other genes on the same or other chromosomes, unless you are looking at linkage and linkage only matters when dealing with two very proximal genes
Also, there are more than just six gene groups. I can think of at least a dozen.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
HypoLyf (03-29-2013),TessadasExotics (03-29-2013),TheSnakeGeek (04-01-2013)
-
Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by interloc
Clearly you don't know who aspilundii is( sorry cant spell). Basically he knows a redonk amount about genetics and if he says something is the way it is, there is a great chance that's what it is.
Thank you for the props interloc . To be fair, I do not post on these boards that often and I do not expect everyone to know who I am. And while I may know a "redonk amount about genetics" there are still times I am wrong so I do not mind engaging in a good, well-spirited debate.
 Originally Posted by interloc
Not everything is on WOBP. It's fun to mess around with but it isn't the final say in balls.
This I think is the best message here. WoBP is not the end all be all. For me, it is a great place to look at pictures but I do not look for much else on it.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by asplundii
Thank you for the props interloc  . To be fair, I do not post on these boards that often and I do not expect everyone to know who I am. And while I may know a "redonk amount about genetics" there are still times I am wrong so I do not mind engaging in a good, well-spirited debate.
This I think is the best message here. WoBP is not the end all be all. For me, it is a great place to look at pictures but I do not look for much else on it.
I see you post on BLBC more than here and I value your knowledge and thank you or giving it.
-
-
Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by interloc
Clearly you don't know who aspilundii is( sorry cant spell). Basically he knows a redonk amount about genetics and if he says something is the way it is, there is a great chance that's what it is.
Also. Ever think that maybe others know more about genetics than you and they haven't made those combos because they wouldn't be that cool? Or maybe they were made and not posted? Or maybe they were not made and are some people's projects? Not everything is on WOBP. It's fun to mess around with but it isn't the final say in balls.
i know that others know more than i do when it comes to genetics. But i also know what i know and keep learning 
i think there are two options: Either these morphs appear sooner or later, or they dont. And im open to the possibility that maybe these combinations are impossible to obtain within a reasonable amount of breedings. And im not limited to WOBP, im willing to look at anything that could help here.
asplundii Kurt, you are confusing your terminology which in turn is confusing you.
Gene complexes have nothing to do with the number of chromosomes. Theoretically it is entirely possible for the mutations that gives rise to every known morph to all be located on a single chromosome (and, no, I do not honestly believe that is the case but that does not change the fact that it is possible.) You point out that there are 18 chromosome pairs in ball pythons as if that means something about the number of morph alleles that are possible and how they have to group. The number of chromosomes means very little when it comes to the number of genes in the animal total and how they are grouped. The genes for BluEL and BlkEL could be on the same chromosome or different chromosomes and you would never know without a molecular level investigation.
Gene complexes are just groups of genes that are all alleles of one another. All alleles have to sit at the same locus on the chromosome but beyond that there is no real affiliation with other genes on the same or other chromosomes, unless you are looking at linkage and linkage only matters when dealing with two very proximal genes
Also, there are more than just six gene groups. I can think of at least a dozen.
Now that is a helpful and on-topic response Of course i dont agree with everything. Yes, ill admit terminology is not my strength. I am fully aware that animals have tens of thousands of genes or even hundreds of thousands, on a set of chromosomes that is often very limited. Evolutionary it is true that it is significant if different genes sit on the same locus (same location on the same chromosome), and when genes just sit on the same chromosome but far apart from each other, it doesnt matter much because crossovers between chromosomes do happen. But evolution has time, millions of indviduals, millions of years. For us BP breeders, it does make a difference if two genes are on one chromosome or not.
Theoretically it is entirely possible for the mutations that gives rise to every known morph to all be located on a single chromosome (and, no, I do not honestly believe that is the case but that does not change the fact that it is possible.)
That is statistically impossible, because while gene transfer within a chromosome pair does happen, it is much more rare than simple recombination of chromosomes. Recombination of chromosomes happens every generation, gene exchange within a chromosome happens maybe once in 1000, or once in 10000. I dont dispute that it is a difference if two genes just sit on the same chromosome, OR if they sit on the same chromosome but also on the same location within that chromosome. Like for example albino, toffee, candy, it must be the same chromosome and the same location on the same chromosome. But if you can breed a super pastel super enchi without any problems, and you breed it to a normal and get 100% pastel enchis, that proves without any doubt that these two genes MUST be on different chromosomes. Or think about morphs with 4, 5 or more genes in them.
You point out that there are 18 chromosome pairs in ball pythons as if that means something about the number of morph alleles that are possible and how they have to group.
i think it means we have a chance to organize the morphs we know onto chromosomes without requiring genetic sequencing, using logic and statistics and breeding alone.
The genes for BluEL and BlkEL could be on the same chromosome or different chromosomes and you would never know without a molecular level investigation.
we know for a fact that these two gene complexes must reside on different chromosomes, because there are some morphs we can produce with good chances, like 12,5% or 25% or 6,25%, depending on the pairing. And to produce these if they would be on the same chromosome would be close to impossible, i mean, not in STRICTLY EVOLUTIONARY terms, but the odds would be like 0.01% because you need a crossover. the morphs: sulfur mystic mojave, sulfur super mojave, super mojave vanilla. Ok, not highly visible morphs, but still.
-
-
Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by Kurtilein
Evolutionary it is true that it is significant if different genes sit on the same locus (same location on the same chromosome), and when genes just sit on the same chromosome but far apart from each other, it doesnt matter much because crossovers between chromosomes do happen. But evolution has time, millions of indviduals, millions of years. For us BP breeders, it does make a difference if two genes are on one chromosome or not.
It does make a difference and then again it does not make a difference.
As this thread is progressing it is becoming more obvious to me that you are basically driving at linkage. Once upon a time I had a slide deck worked out for this, I will see if I can 1) find it, 2) upload it and 3) post it, but that will probably not be until Monday at the earliest.
 Originally Posted by Kurtilein
That is statistically impossible, because while gene transfer within a chromosome pair does happen, it is much more rare than simple recombination of chromosomes. Recombination of chromosomes happens every generation, gene exchange within a chromosome happens maybe once in 1000, or once in 10000. I dont dispute that it is a difference if two genes just sit on the same chromosome, OR if they sit on the same chromosome but also on the same location within that chromosome. Like for example albino, toffee, candy, it must be the same chromosome and the same location on the same chromosome. But if you can breed a super pastel super enchi without any problems, and you breed it to a normal and get 100% pastel enchis, that proves without any doubt that these two genes MUST be on different chromosomes. Or think about morphs with 4, 5 or more genes in them.
It is not statistically impossible, always remember Clarke's First Law: "When a distinguished but elderly scientist states that something is possible, he is almost certainly right. When he states that something is impossible, he is very probably wrong" 
I granted that it is totally unlikely but it is certainly possible.
Rough math here: Humane genome is ~25,000 genes on 23 chromosomes which works out to ~1000 genes per chromosome. Assume this as standard unit of measure (yes, an assumption but like I said, rough math here). So any one Ball python chromosome has ~1000 genes, for good measure we call half of them essential which leaves up ~500 genes that are possible to mutate and give a viable phenotype. There are how many base morphs?? Does not really matter because it is theoretically possible for all of them to be on a single chromosome when there are ~500 possible genes you can mutate.
And you can certainly have Enchi and Pastel on the same chromosome and get 100% Pastel Enchi from a SuperPastel SuperEnchi x normal breeding. The how and why will have to wait for my slide deck though.
 Originally Posted by Kurtilein
i think it means we have a chance to organize the morphs we know onto chromosomes without requiring genetic sequencing, using logic and statistics and breeding alone.
To a point yes, but again, this is going in to the realm of linkage. In a nutshell though, there comes a point where the greater the linkage distance between any two genes the harder it is to determine if they are on the same chromosome or different chromosomes.
 Originally Posted by Kurtilein
we know for a fact that these two gene complexes must reside on different chromosomes, because there are some morphs we can produce with good chances, like 12,5% or 25% or 6,25%, depending on the pairing. And to produce these if they would be on the same chromosome would be close to impossible, i mean, not in STRICTLY EVOLUTIONARY terms, but the odds would be like 0.01% because you need a crossover. the morphs: sulfur mystic mojave, sulfur super mojave, super mojave vanilla. Ok, not highly visible morphs, but still.
No, we do not know for a fact that BluEL and BlkEL are on different chromosomes for the reason I stated above. If they are on the same chromosome but have sufficient linkage distance then they will behave in a manner that is basically indistinguishable from two genes on separate chromosomes.
I will hunt down that slide deck and see if I can make things clearer next week
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
 Originally Posted by asplundii
Kurt, you are confusing your terminology which in turn is confusing you.
Gene complexes have nothing to do with the number of chromosomes. Theoretically it is entirely possible for the mutations that gives rise to every known morph to all be located on a single chromosome (and, no, I do not honestly believe that is the case but that does not change the fact that it is possible.) You point out that there are 18 chromosome pairs in ball pythons as if that means something about the number of morph alleles that are possible and how they have to group. The number of chromosomes means very little when it comes to the number of genes in the animal total and how they are grouped. The genes for BluEL and BlkEL could be on the same chromosome or different chromosomes and you would never know without a molecular level investigation.
Gene complexes are just groups of genes that are all alleles of one another. All alleles have to sit at the same locus on the chromosome but beyond that there is no real affiliation with other genes on the same or other chromosomes, unless you are looking at linkage and linkage only matters when dealing with two very proximal genes
Also, there are more than just six gene groups. I can think of at least a dozen.
If only everyone else could understand this. There can be many more than 2 alleles at a locus and one locus can affect another locus or even attach to it. There are so many different combinations and possibilities that can occur.
-
The Following User Says Thank You to TessadasExotics For This Useful Post:
irishanaconda (03-29-2013)
-
Re: Missing morphs 1: Enchi + any 8 ball gene, Albino Fire
just a quick reply because i need to highlight something
To a point yes, but again, this is going in to the realm of linkage. In a nutshell though, there comes a point where the greater the linkage distance between any two genes the harder it is to determine if they are on the same chromosome or different chromosomes.
Yes, exactly! The distance between two genes on the chromosome determines the chance of them crossing over. Often chromosomes, during reproduction, break and get fixed which can exchange a part of the chromosome. When two genes are close together or at the same spot, and such a break/crossover/linkage occurs, chances are low that they are affected, the genes will only be affected by such an event if the breaking point is between their locations. (im really not good in the terminology....). My point is: EVEN IF two genes are on opposite ends of a chromosome, meaning they will be affected by every one of these chromosome-breaking event, its STILL rare, very rare, can only happen when regular cells split into sperm cells / egg cells, once per generation. ive heared numbers, varying, cannot remember them, but ill just limit it in one direction and say it happens in 1 of 1000 eggs at most, its probarbly more rare than that. ill also read up on this stuff, its been a while since i really studied it.
Im in the learning phase when it comes to BP genetics, but i took it to the extreme and am now datamining the 2000 morphs we have so far to find stuff out, and im now starting to run into new and interesting questions.
And if all else fails then the lists im organizing will at least make it easy to find out with which genes you can quite easily make world 1st morphs, and which gene combinations have already been thoroughly explored
Last edited by Pythonfriend; 03-29-2013 at 06:20 PM.
-
-
None of the genes have been "thoroughly" explored.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|