Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,956

0 members and 1,956 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,068
Threads: 249,217
Posts: 2,572,783
Top Poster: JLC (31,651)
Welcome to our newest member, ColorblindChameleon
Results 1 to 10 of 51

Threaded View

  1. #26
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I rarely post here so there is a high likelihood that many/most here do not know who I am and so you will probably question my credibility. So be it. Those of you who do know who I am will understand why I am posting now. To anyone who wants to know more about me and my credibility, you can find my postings in other haunts.

    Now, on with the show.

    I have read the actual research article and I can assure you that the science behind it is absolutely accurate. This is not some smokescreen money-laundering, sheep:cens0r::cens0r::cens0r::cens0r:ers propaganda as Skip is trying to make people believe. I would bet good money that Skip did not even bother to read the real article and is just going off of the major media garbage that is floating around out there. And as far as Skips linking to things Jeff has said in the past... I would love to see Jeff's PhD that gives him the authority to decide anything about microbiology, infectious diseases, genetics, or any science for that matter. Just because Jeff keeps snakes does not mean he knows one whit about science. And something Jeff said 7 years ago should not be held as absolute fact today. The world is not static, new information is learned all the time and people can and do change their minds. And if Jeff still wants to say that IBD is not real and if Skip still wants to say that this article is bull:cens0r::cens0r::cens0r::cens0r:... So be it. Facts do not change simply because you chose to ignore them.


    To clear up some of the things I have seen people here asking/saying...

    The study does not definitively identify these viruses as the source for IBD. However, it does postulate that these viruses are a very likely candidate hence the specific choice of words in the title of the article. The only thing missing to prove the newly discovered agents are the cause would be by executing Koch's Postulate. As reactive as the herp world is I am not surprised that the authors did not set out to do that, they did the next best thing however with their work on cultured cells.

    The viruses described in the article are a new clade of a family of viruses that, until now, has only been found in mammals, primarily, but not exclusively, rodents. Think of it as basically being a newly discovered species related to a know species. It is never really a surprise when a new species is discovered, it is only a surprise when one is discovered somewhere no one bothered to look on the assumption that there was nothing there. And that last is exactly what happened here, it was assumed that these types of viruses only occurred in mammals so no one ever bothered looking for them anywhere else. the great thing about science is that it is self-correcting. So, in addition to finding a new clade of viruses we have also corrected a mistaken assumption that this type of virus can only be found in mammals.

    It is extremely unlikely that the specific viruses discovered and described in the article are transmitted or even able to be carried by rodents (or humans for that matter). Viruses are very host-specific and do not often jump species and those viruses that do jump are most often between self-similar animals. So the potential for a virus that is specific to the unique cellular biochemistry found in a reptile to jump into a mammalian host is on the none side of a slim to none chance. If you have even a basic comprehension of cladistics then the the phylogeny trees in the article will further support the unlikelihood. If you do not understand phylogeny trees then think of it like this: starting with yourself, go backwards on your own family tree eight generations and then climb back up by an entirely different path. You and the person you come back to are technically "family" but your are about as related to them as you are to me. It is that same degree of "family" that GGV and CASV have with the known mammalian viruses in this family. So put to rest any ideas that animals are getting IBD from bad feeder rodents.


    My biggest suggestion is that people who are interested read the actual article at the link that was posted. If you have questions about it, ask someone who knows what they are talking about. Not some wanker like Skip who quite obviously has an axe to grind
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    WarriorPrincess90 (08-16-2012)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1