Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,640

0 members and 1,640 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,051
Threads: 249,211
Posts: 2,572,724
Top Poster: JLC (31,651)
Welcome to our newest member, Panick
Page 6 of 8 FirstFirst 12345678 LastLast
Results 51 to 60 of 73
  1. #51
    BPnet Veteran Mendel's Balls's Avatar
    Join Date
    04-07-2006
    Location
    Pennsylvania
    Posts
    1,073
    Thanks
    94
    Thanked 39 Times in 22 Posts
    Images: 40

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    I actually want to reword what I said earlier.

    In an ideal world, people would never have taken animals from the wild to put in cages, to keep as pets, etc. Hence, I said that ideally all animals that could cause problems would be banned.

    I'm not saying that's a solution. Banning pythons is definitely not the ideal solution, but if it's been a ban or no ban, I choose ban.

    I like the microchipping idea, but then again, an escaped python could already cause problems before capture.

    Don't get me wrong, I don't want a ban on pythons, even though it seems like I do.

    Between the two choices right now though, I choose ban.

    Later, Matt
    Seriously, I dont think anyone can even follow you anymore.....
    ~ 1.0.0 Python regius ~ Wild-type ~
    ~
    1.0.0 Canis familiaris ~ Blue Italian Greyhound ~

    ~ 0.0.9 Danio rerio~ Wild-type and Glofish




  2. The Following User Says Thank You to Mendel's Balls For This Useful Post:

    sweety314 (07-30-2009)

  3. #52
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Mendel's Balls View Post
    Seriously, I dont think anyone can even follow you anymore.....
    Tight, I don't care.
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  4. #53
    BPnet Senior Member daniel1983's Avatar
    Join Date
    12-07-2004
    Posts
    5,677
    Thanks
    31
    Thanked 417 Times in 80 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Personally, I think there are too many 'opinions' and not enough facts. Opinions are dictating this legislation.

    It is like a battle of opinions...

    ...someone needs to organize an effort to actually study the conditions these animals can actually endure. Then produce legislation based on fact.

    As of this moment, the only thing we know is that burms can survive in south Florida. I don't think that is enough support to ban them nationwide.
    -Daniel Hill
    Website: HillHerp.com
    Facebook: facebook.com/hillherp/
    Instagram: instagram.com/hillherp/
    Twitter: twitter.com/hillherp

  5. #54
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by daniel1983 View Post
    Personally, I think there are too many 'opinions' and not enough facts. Opinions are dictating this legislation.

    It is like a battle of opinions...

    ...someone needs to organize an effort to actually study how the conditions these animals can actually endure.
    The Aiken study
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  6. #55
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by qiksilver View Post
    I think if prices were raised, some of this would be avoided. Raise the prices of large pythons enough that they're not 'expendable' this way every jerk who thinks they're tough won't buy one, and the people actually interested will put down the money. Make it a large python tax or something.
    Interesting. I think it would work but many in the Reptile Nation would not accept it.

    How do I know? Well, it looks like USARK and PIJAC are seeing the writing on the wall and coming to the table to assist in penning laws that will satisfy the general public but preserve the majority of our rights.

    ..........and while people are still flying the USARK banners on their sigs, they are apparently not really paying attention to what USARK is doing.

    Which, for the record, I support. This arguing back and forth about whether or not there is a problem when there IS a problem is a waste of time. We have an image problem and we have a discipline problem in this hobby. USARK is doing something very proactive - I just wonder when people will realize that this is not a take no prisoners war - it's a war of taking the bullets out of your opponents gun before he can shoot you with them - or in the case of Florida - performing a surgical amputation of a foot before you lose the whole leg.

    Except for the fuzziness about enforcement, the NC bill was a step in the right direction. Add in a large python tax and we may actually be able to keep dangerous animals out of the hands of people who can't properly care for them.

    Quote Originally Posted by qiksilver View Post
    There's no way to make your average schmoe more responsible, so it's a bit of a catch 22. I see both sides of this argument making sense, but come on people, legislation is a slippery slope, and I don't think vilifying the animals is the way to go. If only there was a way to make keepers more responsible... but there isn't. And so around we go until everyone is arguing with everyone.
    We're already halfway down that slippery slope. USARK has helped pen legislation in NC and is negotiating with HSUS and Nelson in Florida.

    Pay attention folks because this will happen in more and more places. This is the price we all pay for a few bad apples. State by state, USARK and PIJAC will be forced to sit down and help craft legislation that does it's best to cut the baby down the middle.

    Are burms on the loose in Florida because of a hurricane or because of irresponsible owners? Doesn't matter. You can slap each other in the face with insults and throw studies back in forth until everyone is looking for "peer-reviewed" papers and climate change models. While you're doing that, the bills are piling up and new rules are being set.

    So take the time to give PIJAC and USARK some feedback on the work they are doing. Read the bills, and understand that your fight now may not really be a fight, but an attempt to make the laws coming down the pipe easier to bear.

    I've taken the time to give feedback to USARK about the work they are doing. How about some of you take a break from piling on Matt and do the same?

  7. The Following 2 Users Say Thank You to Skiploder For This Useful Post:

    Denial (07-31-2009),DutchHerp (07-31-2009)

  8. #56
    BPnet Veteran GregBennett's Avatar
    Join Date
    09-22-2008
    Location
    Atlanta, GA
    Posts
    248
    Thanks
    51
    Thanked 54 Times in 41 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    Tight, I don't care.
    You sound like one of those nut job PETA or Trout Unlimited People.

    <RANT ON>

    If the founding fathers of this country could see what it has become today, they would roll over in their graves.

    I personally have had enough of our good for just about nothing government telling me what I can and can't do. It seems like today the only purpose of the government is to take our rights away and waste our money feverishly.

    <RANT OFF>

    A few quotes to think about people.

    - They that can give up essential liberty to purchase a little temporary safety, deserve neither liberty nor safety.
    - They that can give up essential liberty to obtain a little temporary safety deserve neither liberty nor safety.
    - Those Who Sacrifice Liberty For Security Deserve Neither.
    - He who would trade liberty for some temporary security, deserves neither liberty nor security.
    - He who sacrifices freedom for security deserves neither.
    - People willing to trade their freedom for temporary security deserve neither and will lose both.
    - If we restrict liberty to attain security we will lose them both.
    - Any society that would give up a little liberty to gain a little security will deserve neither and lose both.
    - He who gives up freedom for safety deserves neither.
    - Those who would trade in their freedom for their protection deserve neither.
    - Those who give up their liberty for more security neither deserve liberty nor security.
    Last edited by GregBennett; 07-31-2009 at 01:20 AM.

    Hognose, Sand Boa & Ball Python Morphs

    Greg Bennett | http://www.hognose.com

  9. The Following User Says Thank You to GregBennett For This Useful Post:

    sweety314 (07-31-2009)

  10. #57
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by yotaman View Post
    You sound like one of those nut job PETA or Trout Unlimited People.


    I am a Person Enjoying Tasty Animals, indeed! Had some lovely Alaskan king crab just now, quite delicious in the harbor of Seward.

    Later, Matt
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  11. #58
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    Texas got freezing temperatures this year; snow actually. If there was viable scientific evidence my pythons could cause ecological problems, then yes, I would relocate them.
    Obviously you do not know much about the environments that carpet pythons inhabit. Better do your research and then pack those babies up and ship them to someone else.

    Quote Originally Posted by Mendel's Balls View Post
    Where is the scientific evidence that points to the Florida Burmese populations causing a net ecological and/or economic loss? Point me to that peer-reviewed scientific paper please.
    There is not one. We all know that. (Well all of us except him it seems...)

    Quote Originally Posted by rabernet View Post
    He can't - but isn't it ironic that he requires scientific proof to give up HIS animals?
    It is ironic. What I find more ironic is that the young lad here lives in Texas where road cruising is illegal and yet he actively practices the habit and posts pics on every forum he is on about it and then defends his actions when called out on it. And here he is telling all of us what ought to be illegal in other states...

    Quote Originally Posted by wolfy-hound View Post
    I got freezing temps several times this year here in Florida too, but you want it illegil in the whole state. So since YOUR animals could live in parts of texas, you should immediately relocate them.
    Like I said above, he needs to learn a little bit more about the native habitats of the carpet python he keeps

    Quote Originally Posted by DutchHerp View Post
    The paper that was linked written by the Barkers is biased and non-scientific.

    I don't have a paper to link, I'm sorry.
    Well I posted a link to a scientifically valid peer reviewed paper. You might want to read it and get yourself properly educated on the matter before you run your mouth off.

    But whatever, I have my opinion and you have yours.
    Yes, we have educated opinions and you have propaganda-based ignorant opinions.

    Quote Originally Posted by DutchHerp View Post
    I actually want to reword what I said earlier.

    In an ideal world, people would never have taken animals from the wild to put in cages, to keep as pets, etc. Hence, I said that ideally all animals that could cause problems would be banned.

    I'm not saying that's a solution. Banning pythons is definitely not the ideal solution, but if it's been a ban or no ban, I choose ban.

    I like the microchipping idea, but then again, an escaped python could already cause problems before capture.

    Don't get me wrong, I don't want a ban on pythons, even though it seems like I do.

    Between the two choices right now though, I choose ban.
    Based on what you said there, then by your own words you ought not be keeping any pets. So, box them up and ship them out.

    Quote Originally Posted by daniel1983 View Post
    Personally, I think there are too many 'opinions' and not enough facts. Opinions are dictating this legislation.

    It is like a battle of opinions...
    I agree but I would add that it is also a battle of emotions. Fear and scare tactics are big power in this fracas we find ourselves in.

    ...someone needs to organize an effort to actually study the conditions these animals can actually endure. Then produce legislation based on fact.
    They are doing that up in the Carolinas right now.

    As of this moment, the only thing we know is that burms can survive in south Florida. I don't think that is enough support to ban them nationwide.
    You are correct, it is not enough support to ban them. There is no justification for a ban, a ban is not going to fix the problem. What is needed is regulation. Something that works to keep impulse buying down and responsible, educated buying safe.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. #59
    BPnet Veteran qiksilver's Avatar
    Join Date
    11-22-2006
    Location
    MA
    Posts
    1,325
    Thanks
    13
    Thanked 56 Times in 36 Posts
    Images: 13

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Skiploder View Post
    How about some of you take a break from piling on Matt and do the same?
    Er, I'm pretty sure I wasn't piling on anything, but alright. I think it's too late to change any minds anywhere, in or out of our community, and I think that Matt brings up solid points on the protection of ecological niches... But that being said, it's not like those making the laws truly care about that. Everyone is being so reactive to everything that there's no way we can all work together. It's just too bad individuals can't take responsibility for their own actions (snake owners and politicians alike). I find it a little ridiculous that no one gave a damn about the ecology of the everglades until they found a convenient scapegoat.
    Mike

  13. #60
    Registered User
    Join Date
    04-28-2008
    Location
    BC. Canada
    Posts
    131
    Thanks
    20
    Thanked 74 Times in 28 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Here is a link to a bunch of quotes from those people that Dutchherp so idolizes so much .
    http://www.naiaonline.org/body/artic...ightsquote.htm

Page 6 of 8 FirstFirst 12345678 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1