» Site Navigation
1 members and 7,517 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,060
Threads: 249,214
Posts: 2,572,756
Top Poster: JLC (31,651)
|
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Serpent_Nirvana
I tend to doubt that ... I guess it is theoretically possible, as we know so little about why, on a molecular level, most mutations manifest the way they do phenotypically, but I have a hard time envisioning that. For example, we could pretend that a spider looks like a spider because its neural crest cells migrate improperly (some NC cells being melanocyte precursors), and that this also somehow affects the migration of certain cells to some part of its nervous system, causing neuro signs. Now pretend that pastel occurs because the pastel has a mutation that decreases the amount of melanin produced. ... I just don't see how that pastel mutation (less melanin) is going to help make up for the improper NC cell/melanocyte migration mutation. (All of this is just speculation of course -- I have no idea what's going on on a molecular level to cause the spider phenotype -- but my point is that I have a hard time seeing a molecular reason that other mutations could "fix" the spider wobble.)
Because lets say the expressed spider gene causes a gap in the allele that is responsible for proper motor function. It is possible that since another mutation has the complete allele that it could fill the missing gap and in turn restore proper motor function. It's 100 percent possible that the gene that causes the spider mutation also causes other physiological like vertigo that can be corrected by additional gene's..It's done in other life forms all the time; I.E. Cows, vegetables, horses, people gene replacement or supplement therapy is a possible solution's to debilitating genetic disorders.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Serpent_Nirvana
Not necessarily ... It's entirely possible that the first spider imported was one that arose through spontaneous mutation.
Beat me to it LOL
Does anyone know if the spider is truly just "dominant" -- meaning that homozygous spiders exist, and just look identical to the heterozygous form -- or if spider is homozygous lethal?
No, no one seems to know. There is a "rumor" of a homozygous spider but I keep hearing it and never seeing any one willing to ante up more than "I know someone who knows someone who knows someone..."
What I wonder is whether the wobble is caused by the spider mutation itself (some epistatic effect), or whether the "wobble gene" is just very close to the "spider gene" on the chromosome, so they're currently linked. If it's the former, I'm not totally sure how it would be possible to "breed out" the wobble -- seems like then it would just be a part of the spiders that we have to accept (or fail to accept, and therefore choose not to work with the mutation). If it's linkage, though, with enough outcrossing we could potentially get rid of that wobble gene ...
Considering the spider is probably the most outcrossed morph out there if it was possible to break "wooble" from the pattern phenotype then we ought to have seen it by now. I am betting it is one and the same gene and we will not see them separated.
 Originally Posted by Freakie_frog
Because lets say the expressed spider gene causes a gap in the allele that is responsible for proper motor function. It is possible that since another mutation has the complete allele that it could fill the missing gap and in turn restore proper motor function.
Ummm, no. The spider gene has a dominant effect over the WT gene so you can not "replace" it by breeding to another morph any more than you can replace it by breeding to a WT. Unless you somehow get a gene duplication event in your breeding you will have a mutant copy and a WT copy of the gene and the mutant copy is the dominant acting source of the "wobble". And duplication events rarely, if ever, copy single genes but instead copy whole blocks of genes which is more likely to cause genetic carnage...
It's 100 percent possible that the gene that causes the spider mutation also causes other physiological like vertigo that can be corrected by additional gene's..
Again, no. If breeding to "morphs" in general is the cure then you ought to see it happen breeding to a WT. I refuse to believe that every morph out there has this magical curative effect and that WT ball do not have it. It is just bogus.
It's done in other life forms all the time; I.E. Cows, vegetables, horses, people gene replacement or supplement therapy is a possible solution's to debilitating genetic disorders.
No. Supplement therapy does not "cure" the mutant gene, it is still there and still exerts its effect in the absence of the supplement. And in gene replacement therapy you are adding in an exogenous functional copy of a defective gene. And it does not actually replace the defective gene, it inserts, via viral means, randomly into the chromosome and functions from those sites. Additionally, in those cases where it is implemented it is with recessive genes where a single WT copy of the gene can exert an effect. It has not been done to correct dominant type defects, which is what the spider mutation is.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by asplundii
Considering the spider is probably the most outcrossed morph out there if it was possible to break "wooble" from the pattern phenotype then we ought to have seen it by now. I am betting it is one and the same gene and we will not see them separated.
And yet I've been told first hand by the people that have bred more spider combos than any one that they have seen normal spider sibs that wobble. 
Ummm, no. The spider gene has a dominant effect over the WT gene so you can not "replace" it by breeding to another morph any more than you can replace it by breeding to a WT. Unless you somehow get a gene duplication event in your breeding you will have a mutant copy and a WT copy of the gene and the mutant copy is the dominant acting source of the "wobble". And duplication events rarely, if ever, copy single genes but instead copy whole blocks of genes which is more likely to cause genetic carnage...
I never said replace it I was implying strengthening the gene by adding in something genetically that its lacking that causes the wobble.
Then if this is 100% true and the spider gene is the only reason for wobbling then it puts to rest the idea that there are spiders that don't wobble.
Again, no. If breeding to "morphs" in general is the cure then you ought to see it happen breeding to a WT. I refuse to believe that every morph out there has this magical curative effect and that WT ball do not have it. It is just bogus.
Again I never said every morph has some curative effect I never said that any morph had a curative effect. But you can't deny that there are things in the gene's of these animals that we don't understand. So to say that it isn't out there also isn't true.
No. Supplement therapy does not "cure" the mutant gene, it is still there and still exerts its effect in the absence of the supplement. And in gene replacement therapy you are adding in an exogenous functional copy of a defective gene. And it does not actually replace the defective gene, it inserts, via viral means, randomly into the chromosome and functions from those sites. Additionally, in those cases where it is implemented it is with recessive genes where a single WT copy of the gene can exert an effect. It has not been done to correct dominant type defects, which is what the spider mutation is.
So your saying that by adding addition working copy's of genetic code in to the DNA of the animal the defective gene can be corrected, not eliminated but corrected in that individual?
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Freakie_frog
The first spider was a WC Juvi if memory serves. Does this mean that he is the only spider ever produced in the wild..My thoughts would be no..Since its a "dominate" gene either its mom or dad had to look like a spider  .
Actually, no. Once upon a time, there WAS a spider that did not have either a spider mom or dad. It was the first spider, where the spontaneous mutation occurred. This has to be true. Whether or not the one that was caught and imported is that original spider, we can only speculate.
 Originally Posted by Freakie_frog
There is a theory that the internal pressure of the egg can increase the risk of kinking in the Caramels. Tims idea is to lower the humidity and by doing so reducing the internal pressure of the egg. Its still just a theory.
I understand it is only a theory. That is why I said "people are trying to find ways to avoid it" instead of that a way to avoid it has already been found. I wasn't trying to say anything specific about caramels so much as illustrate the point that even when some morphs have problems, there may be ways to eliminate those problems.
 Originally Posted by Freakie_frog
Because lets say the expressed spider gene causes a gap in the allele that is responsible for proper motor function. It is possible that since another mutation has the complete allele that it could fill the missing gap and in turn restore proper motor function. It's 100 percent possible that the gene that causes the spider mutation also causes other physiological like vertigo that can be corrected by additional gene's..It's done in other life forms all the time; I.E. Cows, vegetables, horses, people gene replacement or supplement therapy is a possible solution's to debilitating genetic disorders.
I don't understand the point you are trying to make here. What is "a gap in the allele"?
Also, I am a LONG way from an expert on this, but from my limited understanding, gene replacement therapy would replace a mutated gene with a normal copy of that same gene. I don't think replacing it with a different gene on a different locus is likely to do any good at all.
I can see how possibly some genes are redundant or close to redundant. For example, the spider morph and the pinstripe morph have a lot of similarities, even though they are on different loci. So maybe whatever those genes do, it is similar and possibly somewhat redundant. However, in that case, I would expect a spinner to be MORE likely to have problems with wobbles, rather than less. A normal, spider, pin, and spinner all have a total of 4 genes on those 2 loci. So a spinner doesn't have "more" genes; the only thing it has more of is mutated genes. Why would the pinstripe gene do a better job of filling in that gap in the allele (which I still don't really know what you mean by that, so forgive me if this makes no sense) than the normal gene on the pinstripe allele does? If anything, I would think that since the spider and pinstripe morphs have similarities, that a spinner would wobble MORE than a regular spider, because it has less normal genes, and more mutations.
And as far as an apparently totally unrelated gene, such as pastel, helping, I just don't see why or how it could. You said scoliosis is genetic in people, so I'm going to use that example even though I don't personally know if it is or not. Assume there is some sort of genetic therapy to treat scoliosis in people where they give a person a pill with some extra genes (again, I don't know if there is or not, and I don't think gene therapy is really just a pill, but simplifying in order to make a point). Do you think that what they do is put genes for blue eyes in that pill? Or give them normal copies of the gene of which they have a mutated version that causes the scoliosis?
OK, I've had to answer 3 phone calls while writing this reply, so I've really lost my original train of thought and may have missed some of what I wanted to say. I hope it still makes sense. In any event, I'm not trying to argue here. I'm quite sure some of you know more than I do. I'm just trying to understand, and some things aren't making sense to me.
EDIT: I really should learn to check for new replies when I get interrupted and take an exceptionally long time to finish a post. Sorry if this repeats and/or ignores a couple of the most recent posts.
-
-
Re: Do all morphs have diffrent personalities?
What I'm meaning by the "gap" and since we don't know its merely a theory. If you imagine DNA like a ladder with two sides one side having the info for the spider and the other the WT. If the spider gene is missing half of a rung that is responsible for motor function. Now lets just say the normal gene has its half of the info needed to make proper motor function happen but since the spider side doesn't it wobbles. Now lets say you add pastel in the mix again just for an example. You still have the WT side that makes motor function happen but now you also have the pastel gene in the mix that might match complete the gene needed for motor function.
It's just a theory no one really knows how or why they do the wobble thing but its fun to think about the ways it might happen.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Freakie_frog
And yet I've been told first hand by the people that have bred more spider combos than any one that they have seen normal spider sibs that wobble. 
"Wobble" can happen in any morph and it is not necessarily associated with spider breedings. I saw a lesser spinning it's little head off at a show and actually asked the guy if it was from a spider clutch and he said no but I was the third person to ask him that.
I have never heard the information you posted, based on your "more spider combos than any one" I can take a wild stab at who you are referring to and if I am correct then I guess I should not be surprised I have not heard this info before... So, now there may be cases with this one breeder, where spider and "wobble" have been un-linked. Are there others? (Not saying there are not, I just have this thing about a sample size of 1...)
I never said replace it I was implying strengthening the gene by adding in something genetically that its lacking that causes the wobble.
I apologize if I am sounding dense here but how can you "strengthen the gene" without adding the gene itself back in?
Then if this is 100% true and the spider gene is the only reason for wobbling then it puts to rest the idea that there are spiders that don't wobble
.
Like the Jag carpets this is asking to prove a negative which cannot be done. Spiders that are not "wobbling" today may well "wobble" tomorrow, or next week, or next year... Or never if the proper stress event does not trigger them.
Again I never said every morph has some curative effect I never said that any morph had a curative effect.
I apologize if I misread but you seemed to be supporting the statement made early in the thread:
 Originally Posted by Spaniard
Adding the spider gene to a combo morph seems to strengthen it and reduces the frequency of wobbles appearing in combos vs. the spider gene on its own.
That is making a blanket statement that morphs in general are a cure all for "wobble". I disagree with that statement. I do not think morphs make any difference, spiders will "wobble" if they are normal or albino or bee or what ever...
But you can't deny that there are things in the gene's of these animals that we don't understand. So to say that it isn't out there also isn't true.
No I cannot deny that there are things in the genes of these animals that we do not understand. But I would follow that up with the caveat that snakes are not some genetic black box and what happens in one type of animal quite likely happens in another cause that has been show to be the case. So what we know about mutant phenotypes in other animals can give us a pretty good idea what is going on in our snakes.
So your saying that by adding addition working copy's of genetic code in to the DNA of the animal the defective gene can be corrected, not eliminated but corrected in that individual?
No. I am saying that if you take something like cystic fibrosis, which is recessive so a person suffering from it has no functional gene, and add a WT copy of the gene in to the appropriate cells, then you can correct the defective phenotye in those cells. You do not correct the defective gene, it is still there and always will be (for the time being anyways cause we do not have a technology that can rewrite the DNA in every cell of a body.)
By this same token, you cannot use gene therapy to "cure" sickle cell because the mutant allele is dominant. No matter how many normal copies of the allele you introduce you will still have the mutant being expressed and exerting its effect.
 Originally Posted by kc261
I can see how possibly some genes are redundant or close to redundant. For example, the spider morph and the pinstripe morph have a lot of similarities, even though they are on different loci. So maybe whatever those genes do, it is similar and possibly somewhat redundant. However, in that case, I would expect a spinner to be MORE likely to have problems with wobbles, rather than less. A normal, spider, pin, and spinner all have a total of 4 genes on those 2 loci. So a spinner doesn't have "more" genes; the only thing it has more of is mutated genes. Why would the pinstripe gene do a better job of filling in that gap in the allele (which I still don't really know what you mean by that, so forgive me if this makes no sense) than the normal gene on the pinstripe allele does? If anything, I would think that since the spider and pinstripe morphs have similarities, that a spinner would wobble MORE than a regular spider, because it has less normal genes, and more mutations.
You posit an interesting idea there KC. Just because the spider and pin (and woma and GRP) are similar in phenotype they are not necessarily similar in genotype. Off hand I can think of a few different ways to alter pattern that are not genetically related so there would be no shared function between them and you would not therefore see any cumulative effect.
And as far as an apparently totally unrelated gene, such as pastel, helping, I just don't see why or how it could. You said scoliosis is genetic in people, so I'm going to use that example even though I don't personally know if it is or not. Assume there is some sort of genetic therapy to treat scoliosis in people where they give a person a pill with some extra genes (again, I don't know if there is or not, and I don't think gene therapy is really just a pill, but simplifying in order to make a point). Do you think that what they do is put genes for blue eyes in that pill? Or give them normal copies of the gene of which they have a mutated version that causes the scoliosis?
Yes, this is the point I was trying to make. You blue eye genes (pastel) is not going to fix the mutation of scoliosis (spider)..
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Freakie_frog
What I'm meaning by the "gap" and since we don't know its merely a theory. If you imagine DNA like a ladder with two sides one side having the info for the spider and the other the WT. If the spider gene is missing half of a rung that is responsible for motor function. Now lets just say the normal gene has its half of the info needed to make proper motor function happen but since the spider side doesn't it wobbles. Now lets say you add pastel in the mix again just for an example. You still have the WT side that makes motor function happen but now you also have the pastel gene in the mix that might match complete the gene needed for motor function.
It's just a theory no one really knows how or why they do the wobble thing but its fun to think about the ways it might happen.
You can not have DNA floating around single stranded like that in the cell. DNA that is "missing" half a rung is damaged and repaired immediately. DNA repair is quite well studied.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by asplundii
Yes, this is the point I was trying to make. You blue eye genes (pastel) is not going to fix the mutation of scoliosis (spider)..
I think we are just missing each other. I totally understand what your saying but I must be looking at it differently.
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by asplundii
You can not have DNA floating around single stranded like that in the cell. DNA that is "missing" half a rung is damaged and repaired immediately. DNA repair is quite well studied.
Really?? very cool I did not know that..I wonder what effect if any that repaired DNA would have on the animal?
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Do all morphs have diffrent personalities?
So I've gone back and looked up some threads in hopes that I would find the mention of combos showing less wobbles. I know I've read it numerous times and was trying to see who the source was just out of my own curiousity. I couldn't find anything (figures) but I know I didn't pull the information out of the air.
After searching through many threads I did find mention of quite of few combo morphs that showed wobble symptoms. Its seems that a few of the breeders that I respect believe that the combos are equally viable to show wobble symptoms as spiders.
I know when I'm wrong and for the record I would like to retract this statement made above...
Adding the spider gene to a combo morph seems to strengthen it and reduces the frequency of wobbles appearing in combos vs. The spider gene on its own.
I agree with asplundii saying it was too much of a blanket statement. I am however happy that this spurred the discussion it did since I think some good information was shared.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
The Following User Says Thank You to Spaniard For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|