» Site Navigation
0 members and 601 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Re: Do all morphs have diffrent personalities?
 Originally Posted by Serpent_Nirvana
Not necessarily ... It's entirely possible that the first spider imported was one that arose through spontaneous mutation.
Beat me to it LOL
Does anyone know if the spider is truly just "dominant" -- meaning that homozygous spiders exist, and just look identical to the heterozygous form -- or if spider is homozygous lethal?
No, no one seems to know. There is a "rumor" of a homozygous spider but I keep hearing it and never seeing any one willing to ante up more than "I know someone who knows someone who knows someone..."
What I wonder is whether the wobble is caused by the spider mutation itself (some epistatic effect), or whether the "wobble gene" is just very close to the "spider gene" on the chromosome, so they're currently linked. If it's the former, I'm not totally sure how it would be possible to "breed out" the wobble -- seems like then it would just be a part of the spiders that we have to accept (or fail to accept, and therefore choose not to work with the mutation). If it's linkage, though, with enough outcrossing we could potentially get rid of that wobble gene ...
Considering the spider is probably the most outcrossed morph out there if it was possible to break "wooble" from the pattern phenotype then we ought to have seen it by now. I am betting it is one and the same gene and we will not see them separated.
 Originally Posted by Freakie_frog
Because lets say the expressed spider gene causes a gap in the allele that is responsible for proper motor function. It is possible that since another mutation has the complete allele that it could fill the missing gap and in turn restore proper motor function.
Ummm, no. The spider gene has a dominant effect over the WT gene so you can not "replace" it by breeding to another morph any more than you can replace it by breeding to a WT. Unless you somehow get a gene duplication event in your breeding you will have a mutant copy and a WT copy of the gene and the mutant copy is the dominant acting source of the "wobble". And duplication events rarely, if ever, copy single genes but instead copy whole blocks of genes which is more likely to cause genetic carnage...
It's 100 percent possible that the gene that causes the spider mutation also causes other physiological like vertigo that can be corrected by additional gene's..
Again, no. If breeding to "morphs" in general is the cure then you ought to see it happen breeding to a WT. I refuse to believe that every morph out there has this magical curative effect and that WT ball do not have it. It is just bogus.
It's done in other life forms all the time; I.E. Cows, vegetables, horses, people gene replacement or supplement therapy is a possible solution's to debilitating genetic disorders.
No. Supplement therapy does not "cure" the mutant gene, it is still there and still exerts its effect in the absence of the supplement. And in gene replacement therapy you are adding in an exogenous functional copy of a defective gene. And it does not actually replace the defective gene, it inserts, via viral means, randomly into the chromosome and functions from those sites. Additionally, in those cases where it is implemented it is with recessive genes where a single WT copy of the gene can exert an effect. It has not been done to correct dominant type defects, which is what the spider mutation is.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|